ID: 1069853082

View in Genome Browser
Species Human (GRCh38)
Location 10:71423189-71423211
Sequence CAGTGCATGGAGGGTTCGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069853075_1069853082 26 Left 1069853075 10:71423140-71423162 CCTCCAGGAGTTTAAGGTCCAGT 0: 1
1: 1
2: 0
3: 35
4: 279
Right 1069853082 10:71423189-71423211 CAGTGCATGGAGGGTTCGAACGG No data
1069853078_1069853082 8 Left 1069853078 10:71423158-71423180 CCAGTGAAAGAGACAGGCGTGTG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1069853082 10:71423189-71423211 CAGTGCATGGAGGGTTCGAACGG No data
1069853076_1069853082 23 Left 1069853076 10:71423143-71423165 CCAGGAGTTTAAGGTCCAGTGAA 0: 1
1: 0
2: 7
3: 55
4: 312
Right 1069853082 10:71423189-71423211 CAGTGCATGGAGGGTTCGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069853082 Original CRISPR CAGTGCATGGAGGGTTCGAA CGG Intronic
No off target data available for this crispr