ID: 1069853694

View in Genome Browser
Species Human (GRCh38)
Location 10:71426608-71426630
Sequence GTCTGCACCAAGGGTGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069853682_1069853694 25 Left 1069853682 10:71426560-71426582 CCAGGGAGGCAAGTGGGGGCTGC 0: 1
1: 0
2: 1
3: 53
4: 445
Right 1069853694 10:71426608-71426630 GTCTGCACCAAGGGTGAACTTGG No data
1069853681_1069853694 26 Left 1069853681 10:71426559-71426581 CCCAGGGAGGCAAGTGGGGGCTG 0: 1
1: 0
2: 7
3: 34
4: 379
Right 1069853694 10:71426608-71426630 GTCTGCACCAAGGGTGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069853694 Original CRISPR GTCTGCACCAAGGGTGAACT TGG Intronic
No off target data available for this crispr