ID: 1069853694 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:71426608-71426630 |
Sequence | GTCTGCACCAAGGGTGAACT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1069853682_1069853694 | 25 | Left | 1069853682 | 10:71426560-71426582 | CCAGGGAGGCAAGTGGGGGCTGC | 0: 1 1: 0 2: 1 3: 53 4: 445 |
||
Right | 1069853694 | 10:71426608-71426630 | GTCTGCACCAAGGGTGAACTTGG | No data | ||||
1069853681_1069853694 | 26 | Left | 1069853681 | 10:71426559-71426581 | CCCAGGGAGGCAAGTGGGGGCTG | 0: 1 1: 0 2: 7 3: 34 4: 379 |
||
Right | 1069853694 | 10:71426608-71426630 | GTCTGCACCAAGGGTGAACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1069853694 | Original CRISPR | GTCTGCACCAAGGGTGAACT TGG | Intronic | ||
No off target data available for this crispr |