ID: 1069856201

View in Genome Browser
Species Human (GRCh38)
Location 10:71442589-71442611
Sequence CATTGAGGCCAGAGGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069856201_1069856209 17 Left 1069856201 10:71442589-71442611 CCTTCTCCCCTCTGGCCTCAATG No data
Right 1069856209 10:71442629-71442651 TTCTTCATCCGTGGGCTTGTTGG No data
1069856201_1069856211 19 Left 1069856201 10:71442589-71442611 CCTTCTCCCCTCTGGCCTCAATG No data
Right 1069856211 10:71442631-71442653 CTTCATCCGTGGGCTTGTTGGGG No data
1069856201_1069856206 8 Left 1069856201 10:71442589-71442611 CCTTCTCCCCTCTGGCCTCAATG No data
Right 1069856206 10:71442620-71442642 CAATTCTCCTTCTTCATCCGTGG No data
1069856201_1069856207 9 Left 1069856201 10:71442589-71442611 CCTTCTCCCCTCTGGCCTCAATG No data
Right 1069856207 10:71442621-71442643 AATTCTCCTTCTTCATCCGTGGG No data
1069856201_1069856214 26 Left 1069856201 10:71442589-71442611 CCTTCTCCCCTCTGGCCTCAATG No data
Right 1069856214 10:71442638-71442660 CGTGGGCTTGTTGGGGAGGCAGG No data
1069856201_1069856212 22 Left 1069856201 10:71442589-71442611 CCTTCTCCCCTCTGGCCTCAATG No data
Right 1069856212 10:71442634-71442656 CATCCGTGGGCTTGTTGGGGAGG No data
1069856201_1069856210 18 Left 1069856201 10:71442589-71442611 CCTTCTCCCCTCTGGCCTCAATG No data
Right 1069856210 10:71442630-71442652 TCTTCATCCGTGGGCTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069856201 Original CRISPR CATTGAGGCCAGAGGGGAGA AGG (reversed) Intronic
No off target data available for this crispr