ID: 1069858196

View in Genome Browser
Species Human (GRCh38)
Location 10:71453350-71453372
Sequence TCTGCAGAGACTGCCGATGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069858196_1069858204 22 Left 1069858196 10:71453350-71453372 CCCGCATCGGCAGTCTCTGCAGA 0: 1
1: 0
2: 0
3: 12
4: 125
Right 1069858204 10:71453395-71453417 GCAGGCCGGCAACTCCCCGCAGG No data
1069858196_1069858202 8 Left 1069858196 10:71453350-71453372 CCCGCATCGGCAGTCTCTGCAGA 0: 1
1: 0
2: 0
3: 12
4: 125
Right 1069858202 10:71453381-71453403 CGGTGCGCCTGCAAGCAGGCCGG No data
1069858196_1069858201 4 Left 1069858196 10:71453350-71453372 CCCGCATCGGCAGTCTCTGCAGA 0: 1
1: 0
2: 0
3: 12
4: 125
Right 1069858201 10:71453377-71453399 GGAGCGGTGCGCCTGCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069858196 Original CRISPR TCTGCAGAGACTGCCGATGC GGG (reversed) Intronic
900106838 1:985309-985331 TCTGCAGGGACAGCGGATTCGGG - Intergenic
900819076 1:4872411-4872433 TCTCCAGAGACTGCAGATGGGGG - Intergenic
901870812 1:12138330-12138352 CCTGGAGAGCCTGCCGCTGCAGG + Exonic
903396647 1:23006632-23006654 TCTGCAGAGAGTCCCGATTAGGG + Intergenic
903522285 1:23959796-23959818 TCGGCAGCGACTGCAGAAGCAGG - Exonic
906553256 1:46684490-46684512 CCTCCAGAGACCGCCGATGAAGG - Exonic
906858967 1:49338578-49338600 TCTGCAGAGCCTGCCCAGGCAGG + Intronic
907321482 1:53605456-53605478 TTCGCAGGGACTGCCGAGGCCGG - Intronic
907655253 1:56335494-56335516 TCTGGAGAGCCTGGGGATGCTGG - Intergenic
908648994 1:66311628-66311650 ACTTCAGAGACTGCTGCTGCTGG - Intronic
912578689 1:110700594-110700616 TCTGCAGAGTCTGGCTATGTGGG - Intergenic
914770361 1:150678573-150678595 TATGCAGAGAGAGCTGATGCTGG + Intronic
915121161 1:153630191-153630213 TCTGCAGTGGCTGCCCAGGCAGG - Intronic
920498122 1:206469803-206469825 TCTTCAGAGACTGCTGGGGCTGG - Intergenic
921112772 1:212055216-212055238 TCTGGAGAGGCTTCCTATGCAGG + Intronic
921181786 1:212637172-212637194 TCTGCAGAGTCAGCCCATGATGG - Intergenic
924900280 1:248390415-248390437 TCTGCAGCGACTGAAGATGGTGG + Intergenic
1068558467 10:58484750-58484772 CATGCAGAGAATGCAGATGCAGG - Intergenic
1069858196 10:71453350-71453372 TCTGCAGAGACTGCCGATGCGGG - Intronic
1073013492 10:100380059-100380081 TTTGGAGAGACTGCCCAGGCTGG - Intergenic
1074479470 10:113806067-113806089 TCTGGAGACAGTGACGATGCTGG - Intergenic
1075483189 10:122799691-122799713 TCTGCAGATTCTGCAGCTGCTGG + Intergenic
1077185223 11:1232765-1232787 TCTGCAGTGAGTGCCCACGCTGG + Exonic
1083797344 11:65024785-65024807 GCTGCAGAGAGTCCAGATGCAGG - Intronic
1089159247 11:116424808-116424830 TCTGCAGAGCCTGCCTATCCAGG + Intergenic
1097008509 12:55936036-55936058 TCTGCAGAGATTGACGATGGTGG + Intronic
1097198441 12:57258048-57258070 TGTGCAGACACTGCTGAGGCTGG + Exonic
1098343950 12:69480816-69480838 TCTGCAAAGACTTCAGATACTGG - Intronic
1102315478 12:111884008-111884030 TGTGCAGAGACTGCCTATGGAGG - Intronic
1104288840 12:127449904-127449926 TCTGCAGTGACTGCTTCTGCAGG - Intergenic
1106309765 13:28543849-28543871 TCACCAGAGCCTGCCTATGCTGG + Intergenic
1106414414 13:29534526-29534548 TCAGCAGATACTGCAGCTGCTGG + Intronic
1107660402 13:42633269-42633291 TCTGGAGAGACAGCAAATGCAGG - Intergenic
1107725827 13:43298369-43298391 GCTGCAGAAACTGCAGTTGCTGG + Exonic
1107898362 13:44988371-44988393 TCTGCAGAGACTGCATAGGCTGG + Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1122069767 14:99198096-99198118 TTGGCAGAGGCTGCCGATGCAGG + Intronic
1130039419 15:80392976-80392998 TCTGCATAGACTAACAATGCAGG - Intronic
1133386871 16:5376908-5376930 TATGAAGAGACTGCCAACGCAGG - Intergenic
1138387519 16:56646109-56646131 TGTGCAGAGGCTGCCTATGCAGG + Intronic
1141149280 16:81552938-81552960 TCAGCAGAGACTTCCAGTGCAGG + Intronic
1141999322 16:87655132-87655154 TCCGCGGTTACTGCCGATGCAGG - Intronic
1142862508 17:2771361-2771383 TCTGTTGTGACTGCCGATGCTGG - Intergenic
1142909309 17:3073558-3073580 TTTGCAGGGACTGAAGATGCAGG - Intergenic
1142925251 17:3230680-3230702 TTTGCAGGGACTGAAGATGCAGG + Intergenic
1144296507 17:13880107-13880129 ACTGCACAGACAGCCCATGCCGG - Intergenic
1144942547 17:18951769-18951791 TCTGAAGATACTGCCGTGGCGGG - Intronic
1147702354 17:42404099-42404121 TCTGCAGATACAGCCTGTGCTGG + Exonic
1149307974 17:55367656-55367678 TTTCCAGACACTGCCGCTGCTGG - Intergenic
1150162200 17:62907998-62908020 TCTGCTGACACTGCCCATCCAGG - Intergenic
1151678103 17:75610244-75610266 GCGGCAGAGACTGCAGGTGCAGG + Intergenic
1152084591 17:78210290-78210312 TCTGCAGTGCTTCCCGATGCTGG - Intergenic
1155186077 18:23387491-23387513 TCTGCAGAGGCTGCTGAGGGCGG - Intronic
1156648112 18:39191572-39191594 TCTGCAGAAACTGACCATGCTGG - Intergenic
1158549319 18:58421782-58421804 TCTCCAAAGCCTGCTGATGCAGG + Intergenic
1158588854 18:58762977-58762999 TCAGCATAGACTGCAGATGCTGG + Intergenic
1159773444 18:72575685-72575707 TCTGGAGAGGCTGAGGATGCAGG + Intronic
1159779854 18:72648415-72648437 TCTCCAGAGACTGCCTATCTTGG + Intergenic
1162931621 19:13960458-13960480 GCTCCAGACACTGCCGCTGCGGG - Exonic
1167483796 19:49748373-49748395 CCTGCAGAGACTGCACGTGCTGG + Exonic
1168519142 19:57034685-57034707 TCAGCAGACACTGCCCCTGCTGG + Intergenic
927681275 2:25141083-25141105 TCTTAAGAGACTGCAGCTGCTGG - Intronic
928885492 2:36143609-36143631 TCTTCAGAGACTGGAGGTGCTGG + Intergenic
929046378 2:37794476-37794498 TCTGAAGGCACTGCCGATGGAGG + Intergenic
933400235 2:81786993-81787015 TCTCCAGAGGCTGGAGATGCAGG - Intergenic
934105988 2:88694840-88694862 TCTGAACAGACAGCCGTTGCAGG + Intronic
937315569 2:120930111-120930133 TGTGCAGAGACAGTCCATGCTGG + Intronic
938071731 2:128311929-128311951 GCAGCAGAGACTGCCCATGGCGG - Intronic
938664565 2:133521162-133521184 ACAGCAGAGACTGCAGATCCAGG + Intronic
941677017 2:168354946-168354968 TATGCAGAAACTCCCTATGCAGG + Intergenic
946400190 2:219464518-219464540 GCTGCAGAGCGTGGCGATGCTGG + Exonic
948237431 2:236401198-236401220 TCTGCAGTGACGGCAGAGGCAGG - Intronic
1173291956 20:41723112-41723134 TCTGCAGAGGCTGCTGATCTTGG - Intergenic
1173979249 20:47210572-47210594 TCTGCAGTCAAAGCCGATGCTGG + Exonic
1174199101 20:48794583-48794605 TCTGCAGAGGCTGCCCTGGCAGG - Intronic
1176064490 20:63187608-63187630 ACTGGAGAGACTGCAGAGGCTGG - Intergenic
1180160285 21:45996083-45996105 TCTGCAGAAACTGCCCAGTCTGG + Intronic
1180177405 21:46097590-46097612 CCTGCAGAAACTGCCGCTCCTGG - Intergenic
1181861077 22:25818677-25818699 GCTGCAGAGACTTCCCCTGCAGG - Intronic
1183200911 22:36385674-36385696 TCCCCAGAGCCTGCCAATGCCGG + Intronic
1183686900 22:39366310-39366332 TCTGCAGACACAGCCGACGTAGG - Intronic
1184457529 22:44620247-44620269 TCAGCAGAGCCTGTCGGTGCAGG + Intergenic
1185133169 22:49052106-49052128 TCTCCAGAGTCTGCCGGGGCCGG - Intergenic
1185159082 22:49212047-49212069 TCTGCAGAGACTCCCTCAGCAGG + Intergenic
1185182743 22:49372611-49372633 ACGGCAGAGACTGCAGCTGCGGG - Intergenic
950128807 3:10527830-10527852 TCTGCAGTGACTGTAGGTGCTGG - Intronic
952952186 3:38533844-38533866 CCTGCAGTGACTGCTGATGCTGG + Intronic
955232863 3:57114313-57114335 TCCGCGGAGACTGCTAATGCTGG + Intronic
955667710 3:61368039-61368061 TCTCCAGAGCCTGAGGATGCAGG - Intergenic
958089819 3:88862358-88862380 TCAGCTGAGACTGCATATGCTGG + Intergenic
958674840 3:97254906-97254928 TCTACAAAGAGTGACGATGCAGG - Intronic
959159201 3:102703546-102703568 CCTGCAGAGACTGCCCTAGCAGG - Intergenic
963829227 3:149989447-149989469 TCTGCAGAGACTGAGTTTGCTGG - Intronic
964577207 3:158185331-158185353 ACTGCAGAGATGGGCGATGCAGG + Intronic
968226762 3:196977282-196977304 TCTGCAGAGACTGGCCATTGTGG + Intergenic
970108960 4:12616552-12616574 TCTCCAGAGTCTGCCCCTGCTGG + Intergenic
975820815 4:78268538-78268560 TCTGGGCAGACTGCCGAGGCAGG - Intronic
981240541 4:142471655-142471677 TCTGCCTACACTGCTGATGCTGG - Intronic
982090707 4:151877695-151877717 GCTGCAGAGACTGTGGAAGCAGG - Intergenic
985563162 5:602099-602121 TCTCCAGAGACCGCAGCTGCAGG - Intergenic
986470682 5:8071310-8071332 ACTGCAGAGAGTCCCCATGCAGG - Intergenic
987438916 5:17932257-17932279 TCTGGAGAGGCTTCCGATCCAGG + Intergenic
992872970 5:81024908-81024930 GCTGCAGGGAAGGCCGATGCCGG + Intronic
997848542 5:137310238-137310260 TTTATAGAGACTGCCCATGCTGG - Intronic
998455162 5:142266427-142266449 TCTGCAGAGACTGCCCCACCAGG + Intergenic
999192186 5:149756677-149756699 TCTGCAGAGTCTACAGAGGCAGG - Intronic
1002073598 5:176695293-176695315 GCTGGAGAGAGTGCCGATTCTGG + Intergenic
1004804474 6:19187753-19187775 TCTCCAGAGACTCCCTATCCTGG + Intergenic
1006744754 6:36333699-36333721 TCTGAAGAGAGAGCAGATGCAGG - Intronic
1007150699 6:39688112-39688134 TCTGGAGAAACTGCCAATCCAGG + Intronic
1007164889 6:39822163-39822185 TCTGCAGAGGGTGGGGATGCTGG - Intronic
1011930277 6:92701935-92701957 TCTGCAGAGCCTGCAGGGGCTGG - Intergenic
1013226649 6:108123744-108123766 AGAGCAGAGACTGCCGGTGCTGG + Intronic
1013464728 6:110408352-110408374 TCTGCAGAAGCTGGAGATGCTGG - Exonic
1014474924 6:121860363-121860385 TCTGCAGAGCCTGCTGCTGGGGG + Intergenic
1017717884 6:157224714-157224736 TCTCCAGCGCCTGCCGCTGCAGG - Intergenic
1017906563 6:158760787-158760809 TCTGCAGAGCCTGGTGCTGCAGG + Intronic
1021114141 7:16729531-16729553 TCAGCAGAGACTGCAGTAGCTGG + Intergenic
1024216547 7:47253929-47253951 GTTGCAGAGACAGCCGGTGCTGG - Intergenic
1028003424 7:85530892-85530914 TCTCCAGAAACTGACTATGCTGG + Intergenic
1029366575 7:100120197-100120219 TCTGCAGAGGCTGCAGGAGCCGG + Intronic
1038135160 8:24777405-24777427 TCTGCAGAGCCTTCCTTTGCTGG - Intergenic
1038857463 8:31349063-31349085 CCTGCAGAGATTGCAGAGGCAGG + Intergenic
1039550188 8:38437784-38437806 TCTGCAGAGACTATGAATGCAGG + Intronic
1045319294 8:101069740-101069762 TCTACAAAGACTGCAGAAGCTGG - Intergenic
1046122770 8:109866228-109866250 TCTGCAGAGCCAACCTATGCAGG - Intergenic
1047004808 8:120609470-120609492 TCAGAAGAGACTGCTGCTGCTGG + Intronic
1049442821 8:142617009-142617031 TCTGCAGAGGCTGTGAATGCAGG + Intergenic
1052743372 9:32415653-32415675 TCCACAGAGTCTGCTGATGCCGG + Intronic
1054862103 9:69964623-69964645 TCACCAGAGCCTGCCCATGCTGG + Intergenic
1057482164 9:95453506-95453528 TCTGCTGGGAGTGCTGATGCTGG - Exonic
1060505099 9:124191829-124191851 TCTGGAGAGACTGGCCAGGCTGG + Intergenic
1060666691 9:125436042-125436064 TGTGCAGAGGCTGGGGATGCAGG + Intergenic
1061638034 9:131927807-131927829 TCTGAAGAAACTGTCGATGATGG + Intronic
1190561596 X:51691316-51691338 TCTGCAGAAGCTGCTGATTCAGG + Intergenic
1190562695 X:51701999-51702021 TCTGCAGAAGCTGCTGATTCAGG - Intergenic
1190887196 X:54540453-54540475 TCTGCTGACACTGCCCCTGCTGG + Intronic
1192840451 X:74849759-74849781 TCTGCAGTCACTGCCACTGCTGG + Intronic