ID: 1069860326

View in Genome Browser
Species Human (GRCh38)
Location 10:71467146-71467168
Sequence CAGAGACCCCAGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069860319_1069860326 -10 Left 1069860319 10:71467133-71467155 CCGCGAGCCCCTTCAGAGACCCC 0: 1
1: 0
2: 1
3: 21
4: 172
Right 1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069860326 Original CRISPR CAGAGACCCCAGAGGGAAGA GGG Intronic
No off target data available for this crispr