ID: 1069861037

View in Genome Browser
Species Human (GRCh38)
Location 10:71471984-71472006
Sequence CAGGCACACCTGTAGATGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069861037_1069861045 22 Left 1069861037 10:71471984-71472006 CCCCACATCTACAGGTGTGCCTG 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1069861045 10:71472029-71472051 ATGATAGGTGATTCAGTTTCAGG No data
1069861037_1069861046 23 Left 1069861037 10:71471984-71472006 CCCCACATCTACAGGTGTGCCTG 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1069861046 10:71472030-71472052 TGATAGGTGATTCAGTTTCAGGG No data
1069861037_1069861047 27 Left 1069861037 10:71471984-71472006 CCCCACATCTACAGGTGTGCCTG 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1069861047 10:71472034-71472056 AGGTGATTCAGTTTCAGGGCTGG No data
1069861037_1069861044 7 Left 1069861037 10:71471984-71472006 CCCCACATCTACAGGTGTGCCTG 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1069861044 10:71472014-71472036 TCTGGTGCTCGACAGATGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069861037 Original CRISPR CAGGCACACCTGTAGATGTG GGG (reversed) Intronic
900472969 1:2863603-2863625 CAGGCCCAGCTGCAGATGCGGGG + Intergenic
901656634 1:10773318-10773340 CCGGCACACCTGAAGATCCGAGG - Intronic
902236724 1:15062432-15062454 CATGCACACCTGTTGAGATGGGG - Intronic
903375396 1:22862717-22862739 GAGGCACATCTGAAGATGTCTGG - Intronic
903565931 1:24265972-24265994 AAGGCACACTTGTAGATATTTGG - Intergenic
905324244 1:37139261-37139283 CAGGGAAACCAGAAGATGTGGGG + Intergenic
905515665 1:38560118-38560140 CAGCCAACCCTGTAAATGTGGGG + Intergenic
912162494 1:107002776-107002798 CATGCAGACTTGTAGATGAGGGG + Intergenic
913169723 1:116221443-116221465 CAGGCAGTCCAGTTGATGTGCGG - Intergenic
915447518 1:155982394-155982416 CATGCATACCCGTACATGTGCGG - Intronic
917038134 1:170772087-170772109 CAGGCACACTTCTAGATGCTTGG + Intergenic
921425146 1:214992736-214992758 CAGGCACTGCTGTAGATGCTGGG - Intergenic
923047025 1:230362889-230362911 CAGGGACACCTGTGCATATGGGG + Intronic
924643556 1:245856657-245856679 CAGACACCCGTGTAGGTGTGTGG + Intronic
1064456835 10:15495333-15495355 CAAGCAAAGCTGTGGATGTGTGG + Intergenic
1064635891 10:17366680-17366702 CTGGGTCACCTGTAGATTTGGGG - Intronic
1065287758 10:24202038-24202060 CAGCCACACCTGGAGCTGAGGGG - Intronic
1065721190 10:28630015-28630037 CAGGCCCTACTGTAGGTGTGGGG - Intergenic
1067118429 10:43453607-43453629 CAGTAACATCTGTAGTTGTGTGG - Intronic
1067136227 10:43609336-43609358 CAGGCACACATGCAGGTGAGTGG + Exonic
1069861037 10:71471984-71472006 CAGGCACACCTGTAGATGTGGGG - Intronic
1070104275 10:73416619-73416641 CAGGGACACCTGACAATGTGTGG + Intergenic
1073095750 10:100978723-100978745 CAGGCTCACCTGGGGATTTGGGG - Intronic
1073219572 10:101859098-101859120 CAGGCACACCCACAGATGTAAGG + Intronic
1074249243 10:111727509-111727531 CAGGCACTCTTCTAGATGTGGGG + Intergenic
1075219744 10:120574833-120574855 CAGGCACTGCACTAGATGTGGGG - Intronic
1075239390 10:120764377-120764399 AAGGCACAGCTGCAGGTGTGTGG - Intergenic
1075940513 10:126387551-126387573 CAGGCACACCTGCGGAGGAGGGG + Intronic
1076049816 10:127323527-127323549 CAGGCACTCGAGTAGATCTGTGG + Intronic
1076607476 10:131698457-131698479 CAGGCACACCTGAAGAAGGGTGG - Intergenic
1077305842 11:1868399-1868421 CTGCCACATCTGTATATGTGTGG - Intronic
1077852213 11:6084616-6084638 AAAGCACACCTGTAAATGTGAGG - Intergenic
1088551145 11:111013599-111013621 CAGGGACATCTCGAGATGTGGGG + Intergenic
1092592071 12:9961391-9961413 CAGGCAGAAATGTAGCTGTGTGG - Intronic
1094193330 12:27719155-27719177 CATGTATACCTGTAGATTTGTGG + Intronic
1095906376 12:47382423-47382445 GAGGGACATCTGCAGATGTGTGG + Intergenic
1099184099 12:79499059-79499081 CTGGCAGACCTCTAGAGGTGAGG - Intergenic
1100222453 12:92520503-92520525 CAGGCACTCCTCTAAATTTGGGG + Intergenic
1101458674 12:104865297-104865319 CAGAAACATCTGTACATGTGAGG - Intronic
1103396196 12:120609059-120609081 CCGGCAGGCCTGTAGAAGTGAGG + Intergenic
1107987968 13:45792155-45792177 AAGGCAGACCATTAGATGTGAGG + Intronic
1108395118 13:49984341-49984363 CAGGCAAACCTGAACATGTATGG + Intergenic
1119390396 14:74287709-74287731 CAGGCACACCTGTGAATGGCTGG - Intronic
1121258192 14:92546833-92546855 CAGGGACACCTGTTGCTTTGGGG - Intronic
1123058761 14:105584890-105584912 CAGGTACAGCTGTACATGGGAGG - Intergenic
1123083088 14:105705116-105705138 CAGGTACAGCTGTACATGGGAGG - Intergenic
1123131532 14:105989711-105989733 CAGACACAACTGAACATGTGGGG + Intergenic
1123765871 15:23477980-23478002 CCAGCACACCTGTGGATGTTGGG - Intergenic
1123894009 15:24809946-24809968 CACTCACACCAGTAGAAGTGGGG - Intergenic
1124415719 15:29471849-29471871 CATGCACACGTGGAGATTTGGGG + Intronic
1125219939 15:37320828-37320850 CAGACAGACCTGTAGCTGAGGGG + Intergenic
1125633009 15:41163349-41163371 CAGGCCCAGCTTTAAATGTGGGG - Intergenic
1127351134 15:58153716-58153738 AAGGCATACCTGTAAGTGTGAGG - Intronic
1130077000 15:80697565-80697587 CAGACACACCTGTATATTTGGGG - Intronic
1132015115 15:98308414-98308436 TAGGCACACCTTGAGATCTGGGG - Intergenic
1136280402 16:29205386-29205408 TAGGAACACCTGGAGTTGTGTGG + Intergenic
1137540157 16:49356397-49356419 CTGGCACCCCTGGAGCTGTGCGG - Intergenic
1140045907 16:71440671-71440693 CTGGGACACCTGCAGCTGTGTGG - Intergenic
1140221650 16:73048279-73048301 CCGGCACGACTGTAGATGTCAGG - Exonic
1141382374 16:83588032-83588054 CCCGTACACCTGGAGATGTGTGG + Intronic
1141895793 16:86957898-86957920 CAGCCACATCTGGAGATGAGGGG + Intergenic
1142329319 16:89440830-89440852 CAGGAACATCTGTGGCTGTGTGG + Intronic
1145211987 17:21020780-21020802 AGGGCGCACCTGCAGATGTGGGG - Intronic
1150473632 17:65458034-65458056 AAAGCACACCTGTGGATGAGAGG + Intergenic
1153135729 18:1915600-1915622 CAGTCACAGATGTGGATGTGTGG - Intergenic
1154046330 18:10908843-10908865 CAGGCAAACCTGGAACTGTGCGG + Intronic
1155678546 18:28460324-28460346 CATACACACCTATAGATATGTGG - Intergenic
1160826350 19:1082253-1082275 GAGGCACACCTGACGCTGTGCGG + Intronic
1162807886 19:13148144-13148166 CAGGCAGATCAGTTGATGTGAGG + Intronic
1163430403 19:17263925-17263947 CAGGCACATCAGCAGATCTGTGG + Intronic
1164702950 19:30298684-30298706 CTGGCATACCTGCAGATATGGGG - Intronic
1164780021 19:30884600-30884622 CAGGCACCCCTCTGCATGTGCGG + Intergenic
925670984 2:6309642-6309664 CAGGCACACCTGTATGCATGTGG - Intergenic
925830353 2:7887955-7887977 AAGGCACTCTTGTAGATGTCAGG + Intergenic
928581524 2:32712677-32712699 GACGCACACCTGTAGTTGGGAGG - Intronic
929933493 2:46276510-46276532 CAGGCACAGTTGTAGGTGTAGGG + Intergenic
932933153 2:76066790-76066812 CAGGCACAACTGTATCTGGGGGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935249856 2:101251972-101251994 CAGACTCACCTGAAGAGGTGGGG + Intronic
937189213 2:120077935-120077957 CAGGCACATCTGTACATGGCTGG + Intronic
939510191 2:143095409-143095431 AAGGCACACCTGTAAGTGTGAGG + Intronic
941989779 2:171543924-171543946 CAGAGAAACCTTTAGATGTGAGG - Intronic
944624536 2:201557986-201558008 AAGGCATACATGTAAATGTGAGG - Intronic
946361486 2:219221570-219221592 CAGGCACTCTTTTAGGTGTGGGG + Intronic
947530694 2:230907091-230907113 CAAGCACCCGTGTGGATGTGGGG + Intergenic
948363494 2:237438835-237438857 CAGGCACATATGTAAATTTGGGG - Intergenic
948831881 2:240602281-240602303 CATGCACACTTGCTGATGTGGGG + Intronic
1168836298 20:879942-879964 CAGGCTCACCTGTTGCTCTGTGG - Intronic
1171021403 20:21587310-21587332 CAAGCAGACCTGGAGATGTGGGG + Intergenic
1171233481 20:23506339-23506361 CAGGCTTGCCTGTAGGTGTGTGG + Intergenic
1172512697 20:35511681-35511703 TTGGCAAACCTGTAGGTGTGCGG - Exonic
1173443330 20:43096587-43096609 CAGGCAGAGCTGTGGATGGGGGG - Intronic
1174225612 20:48996961-48996983 CAGGCAAATCTGTAGATCAGTGG - Intronic
1174486881 20:50866715-50866737 CAGGCACCCCCGGAGCTGTGTGG - Intronic
1175386639 20:58600208-58600230 CAGGGACACCTGGAGATGCATGG - Intergenic
1175858093 20:62133522-62133544 CAGGCACACCTGGAGAGCTTAGG + Intronic
1181631809 22:24155637-24155659 CAGGCAGAAGTGTAGGTGTGTGG - Intronic
1184739648 22:46420392-46420414 GAAGCACACGTGTAAATGTGTGG - Intronic
953477708 3:43219913-43219935 CATCCATACCTGTAGATGTCTGG + Intergenic
953487958 3:43320288-43320310 CAGACAGACTTGTAGATGTTTGG + Intronic
953754264 3:45632967-45632989 CTGGCACACATGGAGCTGTGGGG - Intronic
954437965 3:50505878-50505900 CAGGCACATTGGTAAATGTGGGG + Intergenic
957746408 3:84348589-84348611 CAGGCACACCTTAAAATGTCTGG + Intergenic
962358747 3:134717365-134717387 CATGCACACGTGTGGATGGGTGG - Intronic
962428909 3:135301497-135301519 CAGGAACAGCTGTGGATCTGTGG + Intergenic
968655205 4:1775575-1775597 CAGCCCCACCTGCAGATCTGGGG + Intergenic
971119050 4:23683291-23683313 CAGGCACTGCTCTAGATGTTTGG - Intergenic
973567220 4:52200563-52200585 CAGGCACATCTGAAAGTGTGGGG + Intergenic
975884961 4:78954062-78954084 CAGGCACATATGTAAAAGTGAGG - Intergenic
977630409 4:99236498-99236520 CATGCATGGCTGTAGATGTGGGG - Intergenic
977702044 4:100032283-100032305 CTGGCAGGCCTCTAGATGTGAGG - Intergenic
979586189 4:122420554-122420576 CAGCCATGCCTGTTGATGTGAGG + Intronic
984727791 4:183037953-183037975 CAGGCCCAGCCTTAGATGTGGGG - Intergenic
987216126 5:15739177-15739199 CAGGCCCAGCTGGAGATGCGGGG - Intronic
988993358 5:36692475-36692497 CATCCTCATCTGTAGATGTGGGG + Intergenic
990382421 5:55230844-55230866 CAGGCACACAAGCAGAAGTGGGG - Intergenic
993126666 5:83844165-83844187 CAGACCCACATGTAGATGTGGGG + Intergenic
997224479 5:132198652-132198674 CTGTCTCCCCTGTAGATGTGGGG - Intronic
997666500 5:135633649-135633671 GAGGTAGACATGTAGATGTGAGG + Intergenic
998968597 5:147567184-147567206 CAGGCACACATATATATGTATGG - Intergenic
1000006547 5:157190429-157190451 CAGGCACCACGCTAGATGTGAGG + Intronic
1000386656 5:160680920-160680942 CATGATCACATGTAGATGTGAGG + Intronic
1000510259 5:162172467-162172489 GAGAAAGACCTGTAGATGTGAGG + Intergenic
1003280227 6:4684768-4684790 CAGGCACCCCTGCTGCTGTGAGG - Intergenic
1003486997 6:6588526-6588548 CAGCCACACCTGTAGATTCAAGG + Intronic
1008159624 6:48061300-48061322 CAGGCTCAACTGTAGATGATAGG + Intronic
1013672258 6:112417481-112417503 CAGGGTCACCTGTAGACCTGTGG + Intergenic
1015129373 6:129792672-129792694 CAGGCAGCCCTGTAGGTCTGGGG + Intergenic
1019167890 6:170110945-170110967 CAGCCACACCTGCAAGTGTGTGG + Intergenic
1023290169 7:38660115-38660137 GAGGCACACCTCTGGATGCGAGG + Intergenic
1023483595 7:40660812-40660834 CAGGTACAGCTGTAGATTAGTGG - Intronic
1031763639 7:125746411-125746433 GAGGCACACATATATATGTGGGG + Intergenic
1032760417 7:134935488-134935510 CAGGCACACGAGAAGATGTTGGG + Intronic
1034201732 7:149287005-149287027 AAGTCACACCAGTAGATGTCAGG + Intronic
1035319504 7:158019738-158019760 CAGCCAGGCCTGCAGATGTGGGG - Intronic
1035596793 8:864730-864752 CAGGTGCACCTGTCGATGGGAGG + Intergenic
1039381132 8:37086418-37086440 CAGGTAGACCTGTACATGGGAGG - Intergenic
1042915840 8:73875242-73875264 CTGGCACACCTGTAAATGCTGGG - Intronic
1048474209 8:134728593-134728615 CAGGCACACCTGTCCTGGTGTGG - Intergenic
1048971482 8:139647360-139647382 CAGGCACAGCTGTAGACATGTGG + Intronic
1049500859 8:142964585-142964607 CAGGCACACCTGGGGGTGGGGGG + Intergenic
1052573224 9:30256836-30256858 CATCCACACCTGTAGATCTCAGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053255445 9:36613379-36613401 CAGGCACTTTTCTAGATGTGTGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1057192181 9:93094427-93094449 CAGGCACACAAGCAGATGAGAGG + Intergenic
1057389266 9:94629362-94629384 TAGGCACAGCTGTTGATATGGGG + Intronic
1059064800 9:111072036-111072058 CAGGCTCTCCTGAAGTTGTGAGG - Intergenic
1059092449 9:111374346-111374368 CAGGCACACCTGAAGATATTTGG - Intronic
1060670241 9:125462319-125462341 CAGCCACACATATACATGTGAGG + Intronic
1061178400 9:129010596-129010618 CAGGCACACTTGCTGCTGTGGGG - Intronic
1061341034 9:129981509-129981531 TAGGCACATCTGTAGATTTGGGG - Intronic
1062081980 9:134629137-134629159 CAGCCACACATGTCCATGTGGGG - Intergenic
1189699304 X:43700403-43700425 CAGGGACTCCTGTGGATATGGGG + Intronic
1190316897 X:49157041-49157063 CAGGGAGACGTGCAGATGTGCGG - Intergenic
1190317866 X:49163178-49163200 CAGGGAGACGTGCAGATGTGCGG + Intronic
1190924239 X:54887534-54887556 CATTCTCACCTGTAGAGGTGGGG - Intergenic
1192611195 X:72569057-72569079 GAGTCACTACTGTAGATGTGAGG - Intronic
1193268904 X:79506705-79506727 CATGCACACCTGAAGCTGTTGGG - Intergenic
1193928467 X:87521393-87521415 CAGGCACTCTTCTAGATGTTAGG + Intronic
1195710511 X:107769738-107769760 CACACACACTAGTAGATGTGGGG + Intronic
1198915596 X:141668062-141668084 CAGGCACAAATGAAAATGTGTGG - Intronic
1200833878 Y:7713921-7713943 CAGGCACACCTGGACATGCCTGG - Intergenic