ID: 1069862555

View in Genome Browser
Species Human (GRCh38)
Location 10:71480714-71480736
Sequence CTGAGTGCAGAGAAGGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069862548_1069862555 18 Left 1069862548 10:71480673-71480695 CCACTGCTGGGGCTGGTGAGGAA 0: 1
1: 0
2: 4
3: 28
4: 368
Right 1069862555 10:71480714-71480736 CTGAGTGCAGAGAAGGCTGGAGG No data
1069862545_1069862555 25 Left 1069862545 10:71480666-71480688 CCAGGAGCCACTGCTGGGGCTGG 0: 1
1: 0
2: 9
3: 71
4: 629
Right 1069862555 10:71480714-71480736 CTGAGTGCAGAGAAGGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069862555 Original CRISPR CTGAGTGCAGAGAAGGCTGG AGG Intronic
No off target data available for this crispr