ID: 1069862812

View in Genome Browser
Species Human (GRCh38)
Location 10:71481956-71481978
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069862801_1069862812 -2 Left 1069862801 10:71481935-71481957 CCTGCTGAGTGGCCAGGAGAGCC No data
Right 1069862812 10:71481956-71481978 CCTGGGCTGCAAAGGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr