ID: 1069862812 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:71481956-71481978 |
| Sequence | CCTGGGCTGCAAAGGGTGGG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1069862801_1069862812 | -2 | Left | 1069862801 | 10:71481935-71481957 | CCTGCTGAGTGGCCAGGAGAGCC | No data | ||
| Right | 1069862812 | 10:71481956-71481978 | CCTGGGCTGCAAAGGGTGGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1069862812 | Original CRISPR | CCTGGGCTGCAAAGGGTGGG GGG | Intronic | ||
| No off target data available for this crispr | |||||