ID: 1069868504

View in Genome Browser
Species Human (GRCh38)
Location 10:71518928-71518950
Sequence GCCCATTGGGGGCGTGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069868490_1069868504 16 Left 1069868490 10:71518889-71518911 CCTGGTCCCTCATGTCCCCTGTA 0: 1
1: 0
2: 0
3: 21
4: 176
Right 1069868504 10:71518928-71518950 GCCCATTGGGGGCGTGGCCAAGG No data
1069868488_1069868504 18 Left 1069868488 10:71518887-71518909 CCCCTGGTCCCTCATGTCCCCTG 0: 1
1: 0
2: 3
3: 26
4: 356
Right 1069868504 10:71518928-71518950 GCCCATTGGGGGCGTGGCCAAGG No data
1069868489_1069868504 17 Left 1069868489 10:71518888-71518910 CCCTGGTCCCTCATGTCCCCTGT 0: 1
1: 0
2: 1
3: 34
4: 298
Right 1069868504 10:71518928-71518950 GCCCATTGGGGGCGTGGCCAAGG No data
1069868492_1069868504 9 Left 1069868492 10:71518896-71518918 CCTCATGTCCCCTGTAACACCAC 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1069868504 10:71518928-71518950 GCCCATTGGGGGCGTGGCCAAGG No data
1069868487_1069868504 25 Left 1069868487 10:71518880-71518902 CCAAGGACCCCTGGTCCCTCATG 0: 1
1: 0
2: 0
3: 23
4: 258
Right 1069868504 10:71518928-71518950 GCCCATTGGGGGCGTGGCCAAGG No data
1069868491_1069868504 10 Left 1069868491 10:71518895-71518917 CCCTCATGTCCCCTGTAACACCA 0: 1
1: 0
2: 1
3: 13
4: 185
Right 1069868504 10:71518928-71518950 GCCCATTGGGGGCGTGGCCAAGG No data
1069868495_1069868504 -1 Left 1069868495 10:71518906-71518928 CCTGTAACACCACCTCTTCCATG 0: 1
1: 0
2: 0
3: 16
4: 225
Right 1069868504 10:71518928-71518950 GCCCATTGGGGGCGTGGCCAAGG No data
1069868494_1069868504 0 Left 1069868494 10:71518905-71518927 CCCTGTAACACCACCTCTTCCAT 0: 1
1: 0
2: 1
3: 15
4: 375
Right 1069868504 10:71518928-71518950 GCCCATTGGGGGCGTGGCCAAGG No data
1069868493_1069868504 1 Left 1069868493 10:71518904-71518926 CCCCTGTAACACCACCTCTTCCA 0: 1
1: 0
2: 1
3: 32
4: 232
Right 1069868504 10:71518928-71518950 GCCCATTGGGGGCGTGGCCAAGG No data
1069868497_1069868504 -10 Left 1069868497 10:71518915-71518937 CCACCTCTTCCATGCCCATTGGG 0: 1
1: 0
2: 0
3: 20
4: 294
Right 1069868504 10:71518928-71518950 GCCCATTGGGGGCGTGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069868504 Original CRISPR GCCCATTGGGGGCGTGGCCA AGG Intronic
No off target data available for this crispr