ID: 1069869281

View in Genome Browser
Species Human (GRCh38)
Location 10:71523392-71523414
Sequence TTGGTAGTCCCCGAGTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069869281_1069869289 26 Left 1069869281 10:71523392-71523414 CCCTCAAACTCGGGGACTACCAA 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1069869289 10:71523441-71523463 CACAGCCCAAAAGATGGAGATGG No data
1069869281_1069869286 20 Left 1069869281 10:71523392-71523414 CCCTCAAACTCGGGGACTACCAA 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1069869286 10:71523435-71523457 GCCCAACACAGCCCAAAAGATGG No data
1069869281_1069869290 29 Left 1069869281 10:71523392-71523414 CCCTCAAACTCGGGGACTACCAA 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1069869290 10:71523444-71523466 AGCCCAAAAGATGGAGATGGAGG No data
1069869281_1069869291 30 Left 1069869281 10:71523392-71523414 CCCTCAAACTCGGGGACTACCAA 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1069869291 10:71523445-71523467 GCCCAAAAGATGGAGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069869281 Original CRISPR TTGGTAGTCCCCGAGTTTGA GGG (reversed) Intronic
904727218 1:32558594-32558616 TTGTTAGTCTCCAAGTCTGAAGG + Intronic
905591245 1:39166001-39166023 TTGATAGTCCCTGTCTTTGAGGG + Intronic
906198362 1:43943899-43943921 TTTGTAGTCCCCTGGTTTGAGGG - Intergenic
908479905 1:64528870-64528892 ATGGTAGTCCCCCAATTTAATGG + Intronic
914249020 1:145906814-145906836 TTGGTAGTCACCTGGTTGGAAGG + Exonic
920099038 1:203505450-203505472 CTGGTGGTCCCCGAGTCTGGAGG + Intronic
924929997 1:248721999-248722021 GTGGTAGTCATCCAGTTTGAAGG + Intronic
1067288050 10:44921775-44921797 TTGGGAGGCCCAGAGTCTGAGGG - Intronic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1078637888 11:13068875-13068897 TTGGAAGTCCCCAGGCTTGAGGG - Intergenic
1086676458 11:89613755-89613777 TTGGTAGTCCCCATGTTTTCTGG + Intergenic
1086895978 11:92313275-92313297 TTGGTAGTCCCAGATGTGGATGG - Intergenic
1087558136 11:99748651-99748673 TTTGGAGTCCCAGAGTCTGAAGG + Intronic
1100790056 12:98120417-98120439 TTGATAGTACCATAGTTTGAAGG - Intergenic
1120961349 14:90127953-90127975 TTGGTAGTTGCCCAGGTTGAAGG + Intronic
1121177266 14:91899907-91899929 TTTGTTGTCCCCGAGATTGTTGG - Intronic
1121514838 14:94542704-94542726 TTGGTAGTCCCTGACCTTCAGGG - Intergenic
1124258421 15:28164841-28164863 TTGGCAGTCTCCTGGTTTGAGGG - Intronic
1128696035 15:69763560-69763582 TTAGTTGTCCCTAAGTTTGATGG + Intergenic
1148808824 17:50277920-50277942 GTGGAAGTCCCCGAGTTTGTTGG - Intronic
1150246195 17:63677339-63677361 TTGGTAGTCCACAAGTTCTATGG - Intronic
1151807105 17:76412583-76412605 TTGGTTGTCCCTGAGCTTGAAGG + Intronic
1153656402 18:7286640-7286662 TTGTAAGTCCCAGAGTCTGAAGG + Intergenic
1155844256 18:30685584-30685606 TTGGAAGTTTCTGAGTTTGATGG - Intergenic
927530369 2:23792389-23792411 TTGTTAGTCCCCAGTTTTGAAGG + Intronic
931215690 2:60242086-60242108 GTGTTAGTCCCAGAGTCTGAAGG - Intergenic
941333313 2:164207700-164207722 TTGCTAGTCCCCCAGCTGGATGG + Intergenic
1172684923 20:36746194-36746216 TCGGTAGTTCCCGAGGTGGACGG - Intergenic
1176341311 21:5698192-5698214 TCGATTGTCCCCGTGTTTGAGGG - Intergenic
1176473565 21:7130345-7130367 TCGATTGTCCCCGTGTTTGAGGG - Intergenic
1176503516 21:7626264-7626286 TCGATTGTCCCCGTGTTTGAGGG + Intergenic
1181267769 22:21641060-21641082 TTGGTAGTCCCTGCACTTGAGGG - Intergenic
1182979213 22:34652580-34652602 TTGGTTGTCCCCTACTTTCAAGG - Intergenic
1203240574 22_KI270733v1_random:12656-12678 TCGATTGTCCCCGTGTTTGAGGG - Intergenic
954702269 3:52456465-52456487 CGGGTAGTTCCCGACTTTGACGG + Intronic
956831220 3:73050501-73050523 TTGGTTTTCCACCAGTTTGAGGG + Intronic
964557453 3:157955209-157955231 TGGGTTGTCTCCCAGTTTGAAGG - Intergenic
967363130 3:188654919-188654941 ATTGTAGTCCAGGAGTTTGATGG + Intronic
974424433 4:61722875-61722897 TTAATAGTCCCAGAGTTTGGAGG - Intronic
979689350 4:123544025-123544047 CTGCTAGTCCCAGAGTTTGGCGG + Intergenic
981698932 4:147586722-147586744 TTGGCAGCCCCCGAGTCTGGAGG + Intergenic
992286644 5:75242291-75242313 TTTGCAGTCCCTGAGCTTGATGG - Intergenic
1006620311 6:35359349-35359371 CTGGTAGTCCCTAAGTATGATGG - Intronic
1012002257 6:93667593-93667615 TTGCAAGTCCCAGAGTTTAAAGG - Intergenic
1019787161 7:2984372-2984394 GTGTCAGTCCCAGAGTTTGAAGG - Intronic
1024478483 7:49839405-49839427 TTGGTTGTCCTCAAATTTGATGG - Intronic
1033360227 7:140633886-140633908 TTGGTAGTAGCCGAGGTTGGAGG - Intronic
1041724250 8:61003550-61003572 TTGTTAGTCACAGAATTTGATGG + Intergenic
1044590269 8:93907559-93907581 TTGAGAGTCCCAGAGTTGGAGGG + Intronic
1050136056 9:2465890-2465912 TTTGTAGTCCCCTTGTATGAGGG + Intergenic
1055407692 9:75991804-75991826 TTGGTAGTCCCAGATTCTTAAGG - Intronic
1194775755 X:97962049-97962071 TTAGTAGTCACCTAGATTGATGG - Intergenic
1195234211 X:102880836-102880858 TTGGAAGTCCCCAAATTTGCAGG + Intergenic
1197153681 X:123247371-123247393 TTTATAGTCCCCGAGTCTGTAGG - Intronic
1202174132 Y:22081899-22081921 TTTGTAGGCCCCTGGTTTGAAGG + Intronic
1202217228 Y:22504483-22504505 TTTGTAGGCCCCTGGTTTGAAGG - Intronic
1202325958 Y:23691576-23691598 TTTGTAGGCCCCTGGTTTGAAGG + Intergenic
1202544813 Y:25978478-25978500 TTTGTAGGCCCCTGGTTTGAAGG - Intergenic