ID: 1069869281

View in Genome Browser
Species Human (GRCh38)
Location 10:71523392-71523414
Sequence TTGGTAGTCCCCGAGTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069869281_1069869289 26 Left 1069869281 10:71523392-71523414 CCCTCAAACTCGGGGACTACCAA No data
Right 1069869289 10:71523441-71523463 CACAGCCCAAAAGATGGAGATGG No data
1069869281_1069869291 30 Left 1069869281 10:71523392-71523414 CCCTCAAACTCGGGGACTACCAA No data
Right 1069869291 10:71523445-71523467 GCCCAAAAGATGGAGATGGAGGG No data
1069869281_1069869290 29 Left 1069869281 10:71523392-71523414 CCCTCAAACTCGGGGACTACCAA No data
Right 1069869290 10:71523444-71523466 AGCCCAAAAGATGGAGATGGAGG No data
1069869281_1069869286 20 Left 1069869281 10:71523392-71523414 CCCTCAAACTCGGGGACTACCAA No data
Right 1069869286 10:71523435-71523457 GCCCAACACAGCCCAAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069869281 Original CRISPR TTGGTAGTCCCCGAGTTTGA GGG (reversed) Intronic