ID: 1069869282

View in Genome Browser
Species Human (GRCh38)
Location 10:71523393-71523415
Sequence TTTGGTAGTCCCCGAGTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069869282_1069869290 28 Left 1069869282 10:71523393-71523415 CCTCAAACTCGGGGACTACCAAA 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1069869290 10:71523444-71523466 AGCCCAAAAGATGGAGATGGAGG No data
1069869282_1069869286 19 Left 1069869282 10:71523393-71523415 CCTCAAACTCGGGGACTACCAAA 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1069869286 10:71523435-71523457 GCCCAACACAGCCCAAAAGATGG No data
1069869282_1069869291 29 Left 1069869282 10:71523393-71523415 CCTCAAACTCGGGGACTACCAAA 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1069869291 10:71523445-71523467 GCCCAAAAGATGGAGATGGAGGG No data
1069869282_1069869289 25 Left 1069869282 10:71523393-71523415 CCTCAAACTCGGGGACTACCAAA 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1069869289 10:71523441-71523463 CACAGCCCAAAAGATGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069869282 Original CRISPR TTTGGTAGTCCCCGAGTTTG AGG (reversed) Intronic
904877362 1:33666448-33666470 TTTGGCAGTCCACAAGTTTATGG + Intronic
906198363 1:43943900-43943922 CTTTGTAGTCCCCTGGTTTGAGG - Intergenic
909058666 1:70853065-70853087 TTTTTTACACCCCGAGTTTGTGG - Intronic
920269964 1:204755371-204755393 TTTGCCAGTCCTGGAGTTTGGGG - Intergenic
923525209 1:234767311-234767333 TTTGGGATTCCCAGAGTCTGTGG + Intergenic
1064845871 10:19652379-19652401 TTTAGTAGTGCTCGAGTATGTGG + Intronic
1067288051 10:44921776-44921798 TTTGGGAGGCCCAGAGTCTGAGG - Intronic
1067977172 10:51039706-51039728 TTTAGTAGTCACATAGTTTGAGG + Intronic
1068222675 10:54064014-54064036 TTTGGTGGGTCCCGAGTTTTTGG + Intronic
1068817215 10:61330909-61330931 TTTGTTAGTCCTGGAGATTGAGG - Intergenic
1068841269 10:61616962-61616984 TAATGTAGTCCCAGAGTTTGAGG + Intergenic
1069869282 10:71523393-71523415 TTTGGTAGTCCCCGAGTTTGAGG - Intronic
1070328602 10:75403114-75403136 CTTAGAAGTCTCCGAGTTTGGGG - Intergenic
1070701243 10:78603158-78603180 GTTTGAAGTCCCCCAGTTTGTGG - Intergenic
1073498091 10:103912274-103912296 TTTGGGAGGCCAAGAGTTTGAGG - Intronic
1083940248 11:65891659-65891681 TTTGGTACTCGCCGGGGTTGGGG + Intergenic
1087663991 11:101021087-101021109 TGTGGTAGTCCCAGATTTTCAGG - Intergenic
1090909394 11:131105294-131105316 TTTATTAGTCCCCTAGTTTAGGG - Intergenic
1112658497 13:101479337-101479359 TTTAGTAGTTTCCTAGTTTGAGG - Intronic
1114357683 14:21930405-21930427 TTTAGTAGTCACAGAGTTTCAGG - Intergenic
1121970988 14:98355596-98355618 TTTGTTAGCCCCTAAGTTTGTGG - Intergenic
1124258422 15:28164842-28164864 TTTGGCAGTCTCCTGGTTTGAGG - Intronic
1129996447 15:80010318-80010340 TTTGGTAGTACCAGAGGTTTAGG + Intergenic
1138938709 16:61762853-61762875 ATTGGGATTCCCTGAGTTTGGGG - Intronic
1142342147 16:89530775-89530797 ACTGGAAGTCCGCGAGTTTGTGG + Exonic
1150541754 17:66108178-66108200 TTTAGTAGTTTCCTAGTTTGAGG - Intronic
1166625419 19:44348195-44348217 TTTGGTATTCAACGAGTTTCTGG + Intronic
926519204 2:13889025-13889047 TTTAGTAGTTCCATAGTTTGAGG - Intergenic
928925853 2:36578529-36578551 TGTGGTAGTCCCAGCCTTTGGGG - Intronic
930229943 2:48833418-48833440 TGTGGTAGTTTCAGAGTTTGGGG + Intergenic
935893918 2:107713009-107713031 TTTGGCAGTCCTCTTGTTTGAGG - Intergenic
937645034 2:124257198-124257220 TTTGCAAATCCCCCAGTTTGTGG + Intronic
938289242 2:130140749-130140771 TCTGGTGATCCCTGAGTTTGCGG - Intronic
938467284 2:131532189-131532211 TCTGGTGATCCCTGAGTTTGCGG + Intronic
939752050 2:146060142-146060164 TTTAGTAGTTCCATAGTTTGAGG - Intergenic
941370124 2:164654683-164654705 TTTGTTAGTCACCCAGTTTATGG + Intronic
941843230 2:170109687-170109709 TTTGGTAGTTCTGGTGTTTGGGG + Intergenic
1171126007 20:22602722-22602744 TTTGGTTGTCCCACAGCTTGGGG + Intergenic
1175680066 20:60980076-60980098 TTTAGTAGTTTCAGAGTTTGAGG - Intergenic
1181108519 22:20588390-20588412 TCTGGTACTCCCCGAGTTGCCGG - Intergenic
1181267770 22:21641061-21641083 TTTGGTAGTCCCTGCACTTGAGG - Intergenic
951946661 3:28145053-28145075 TTGGGTAGTTCCCAGGTTTGGGG + Intergenic
952602121 3:35096489-35096511 TTTAGTAGTTTCCTAGTTTGAGG + Intergenic
953086586 3:39674286-39674308 TTTGGTAGTTCCTTAGCTTGTGG + Intergenic
955015484 3:55065282-55065304 TTTTGTAGTCCCAGATTTAGGGG + Intronic
961726233 3:128932810-128932832 TGTGGTAGTCCTCAAGATTGGGG + Exonic
963479121 3:145846916-145846938 TTTAGTAGTTCCATAGTTTGAGG + Intergenic
964997520 3:162902964-162902986 TTTGGTAGTTTCAGAGTTTTAGG + Intergenic
965234378 3:166096851-166096873 TTTGGTAGTTTCACAGTTTGAGG - Intergenic
975132206 4:70840949-70840971 TTTGGTACCCCCCGAATTTGAGG + Intergenic
977372465 4:96156654-96156676 TTTGGTAGTCCCTTGGCTTGTGG - Intergenic
990412749 5:55557312-55557334 TTGGATAGTCTCCAAGTTTGAGG + Intergenic
991182087 5:63764342-63764364 TTTGGCAGTCTCAGACTTTGTGG + Intergenic
992714494 5:79496545-79496567 TTGGCTGGTCCCCAAGTTTGGGG - Intronic
998737018 5:145153608-145153630 TTTGGTAGTTTCATAGTTTGAGG + Intergenic
1006008854 6:31025724-31025746 TATAGTAGTCCCTGAGTCTGTGG - Exonic
1032138235 7:129301473-129301495 TTTGGTAGTTGCATAGTTTGAGG + Intronic
1050136055 9:2465889-2465911 TTTTGTAGTCCCCTTGTATGAGG + Intergenic
1050499832 9:6285211-6285233 TTTAGTAGTTCCATAGTTTGAGG + Intergenic
1060880805 9:127116740-127116762 ATTGGTTGTCCCAGTGTTTGAGG - Intronic
1192631064 X:72778078-72778100 GATGGAAGTCCCGGAGTTTGTGG + Intronic
1192650645 X:72942723-72942745 GATGGAAGTCCCGGAGTTTGTGG - Intronic
1197003055 X:121461770-121461792 TTTAGTAGTTTCTGAGTTTGAGG + Intergenic
1197905218 X:131417661-131417683 TTTGGTAGTTCTTGAGTTTTTGG - Intergenic
1198430364 X:136559887-136559909 TTTAGTAGTTCCATAGTTTGAGG + Intergenic
1200748800 Y:6925988-6926010 GTTGGTAGTCTCCAAATTTGGGG + Intronic