ID: 1069869283

View in Genome Browser
Species Human (GRCh38)
Location 10:71523411-71523433
Sequence GAATATTTTTTTCTAAGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 686
Summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 623}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069869283_1069869291 11 Left 1069869283 10:71523411-71523433 CCAAACCTTAGAAAAAAATATTC 0: 1
1: 0
2: 3
3: 59
4: 623
Right 1069869291 10:71523445-71523467 GCCCAAAAGATGGAGATGGAGGG No data
1069869283_1069869289 7 Left 1069869283 10:71523411-71523433 CCAAACCTTAGAAAAAAATATTC 0: 1
1: 0
2: 3
3: 59
4: 623
Right 1069869289 10:71523441-71523463 CACAGCCCAAAAGATGGAGATGG No data
1069869283_1069869290 10 Left 1069869283 10:71523411-71523433 CCAAACCTTAGAAAAAAATATTC 0: 1
1: 0
2: 3
3: 59
4: 623
Right 1069869290 10:71523444-71523466 AGCCCAAAAGATGGAGATGGAGG No data
1069869283_1069869286 1 Left 1069869283 10:71523411-71523433 CCAAACCTTAGAAAAAAATATTC 0: 1
1: 0
2: 3
3: 59
4: 623
Right 1069869286 10:71523435-71523457 GCCCAACACAGCCCAAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069869283 Original CRISPR GAATATTTTTTTCTAAGGTT TGG (reversed) Intronic
902102800 1:14006512-14006534 GCATATTTTTGTGTAAGATTAGG + Intergenic
902135840 1:14304384-14304406 GAATATTTTGGTCTAAGCTGGGG - Intergenic
903113086 1:21154544-21154566 AAATATATTTTTCAAAGTTTTGG + Intronic
905176991 1:36142856-36142878 TAAAATTTTTTTGTAAAGTTGGG - Intronic
907006588 1:50920826-50920848 GAATATTTATCCCTAAGATTAGG + Intronic
907113038 1:51944279-51944301 GAATATTTTTTCCTGAGAGTGGG - Intronic
908981876 1:69968317-69968339 GAATACATTATTCTTAGGTTTGG - Intronic
909008440 1:70304568-70304590 TAATATTTTTTTGTAAAGATGGG + Intronic
909129941 1:71722290-71722312 GAAAATGTTTTTCTAAGGTTAGG - Intronic
909249664 1:73335940-73335962 GAAATTTTTTTTCTAAGGTGTGG - Intergenic
910019255 1:82566783-82566805 GAATATATTTTTCTAAAGAAAGG - Intergenic
910260082 1:85285570-85285592 TAATATTCTTTTCTGAGGCTGGG - Intergenic
910958623 1:92736306-92736328 GAATTTTTTTTTCTATTTTTTGG - Intronic
912657883 1:111504031-111504053 GAATAGTTCTGGCTAAGGTTAGG - Intronic
912872814 1:113325513-113325535 GGATATTTGTTTCTAATGTTGGG - Intergenic
913379157 1:118189287-118189309 GAACATTTTTTCCTAAGTATAGG - Intergenic
914390403 1:147216563-147216585 GAATATTTTTTTAAAAGGCTAGG - Intronic
914460678 1:147880802-147880824 GAATATTTTTTTGTGATCTTGGG - Intergenic
914891092 1:151624135-151624157 AAAAATTTTTTTGTAAAGTTAGG + Intronic
915793882 1:158705695-158705717 CAATTGTTTTTTCTAAGGTGGGG - Intergenic
915947457 1:160164010-160164032 GAATCTTTTGTTCTAATATTTGG - Intronic
916393390 1:164358014-164358036 GAATATTTTTTTTTTAAGTGTGG + Intergenic
916833477 1:168517233-168517255 TAAGATTTTTTTCTAATGATCGG - Intergenic
917209070 1:172613237-172613259 GCATATTTTTTCCTAAAGTAAGG + Intergenic
917722032 1:177794912-177794934 GAAGATGTTTTTCTAAAGTCAGG - Intergenic
918049646 1:180963149-180963171 GCATATTTTTTTTTAAGGCTGGG + Intergenic
918124606 1:181571849-181571871 GGAAATTTTTTTCTAGGGCTGGG + Intronic
918263469 1:182818220-182818242 GAATATTTTATTCTAATACTTGG - Intronic
918507000 1:185266357-185266379 TAATATTTAATTCTAAGGCTGGG - Intronic
918560366 1:185858756-185858778 TAATTTTTTTTTCTTAAGTTTGG + Intronic
918929161 1:190831843-190831865 GAAAAGTTATTTCTAAGGCTAGG + Intergenic
919452136 1:197785331-197785353 TAATATTCTTTGCTAAAGTTTGG + Intergenic
920783551 1:209019008-209019030 GAAACTTTTTTTCTAATTTTAGG + Intergenic
921018948 1:211218784-211218806 GAATATTATTTTAAAAGGCTGGG + Intergenic
921636253 1:217497966-217497988 GAATATTTGTATCTGAAGTTTGG - Intronic
921905313 1:220489549-220489571 GGATTTTTTTTTTTTAGGTTTGG - Intergenic
922405390 1:225307005-225307027 GAATATTTAATTATAAGTTTCGG - Intronic
922732627 1:227959022-227959044 GAACATTTTTGTCTGAGATTTGG + Intergenic
922882519 1:228991514-228991536 GACTATGTTTTTTTCAGGTTTGG - Intergenic
924311154 1:242744443-242744465 GAATCATATTCTCTAAGGTTTGG - Intergenic
924827377 1:247554413-247554435 TATTATTCTTTTCTAAGATTTGG + Intronic
924838238 1:247677285-247677307 GATTATTATATTCTAAGGTAAGG + Intergenic
924889529 1:248259155-248259177 AAATATTTTCTTCTAAGATCAGG - Intergenic
1063014224 10:2059096-2059118 GAATATTTTACTGTAAAGTTTGG + Intergenic
1063020602 10:2123456-2123478 TAAAATTTTTTTTTAATGTTGGG - Intergenic
1063631336 10:7736192-7736214 TAGTATTTTTTTCTAAAGATGGG - Intronic
1064168692 10:13009290-13009312 ATATATTTTTTTCATAGGTTGGG + Intronic
1064259197 10:13771246-13771268 ATATATTTTTTTGTAGGGTTGGG + Intronic
1064685909 10:17861012-17861034 AAATATTATTTTCTAAGGCTGGG + Intronic
1064799272 10:19050577-19050599 TAATATTTTTCTCTTAGTTTGGG + Intronic
1064884257 10:20092022-20092044 GTAAATATTTGTCTAAGGTTGGG - Intronic
1065039929 10:21682613-21682635 GAATTTTATTTTTTAGGGTTTGG + Intronic
1065413333 10:25455391-25455413 AAACTTTTTTTTCTAACGTTTGG + Intronic
1068452013 10:57203037-57203059 AAATATTATTTTCCAAAGTTAGG + Intergenic
1069337300 10:67367317-67367339 GAATATTTTTTTCGTATGTTTGG - Intronic
1069869283 10:71523411-71523433 GAATATTTTTTTCTAAGGTTTGG - Intronic
1070015126 10:72520148-72520170 TAGTATTTCTATCTAAGGTTGGG + Intronic
1071015747 10:80995790-80995812 GAAGATATTATTCTTAGGTTTGG + Intergenic
1072004312 10:91228479-91228501 AAATAATTTATTCTTAGGTTAGG - Intronic
1073010185 10:100352975-100352997 GAAATTTTTTTTTTAAAGTTGGG - Intronic
1073491925 10:103858159-103858181 GCAAATTTTTTTTTAAGTTTAGG + Intergenic
1073712341 10:106057945-106057967 TAACATATTTTTTTAAGGTTAGG - Intergenic
1073894253 10:108136327-108136349 GAATTTTTTTTTTTAATGTTTGG + Intergenic
1074274261 10:111986507-111986529 AAATCTATTTTTCTAAGATTTGG + Intergenic
1074605923 10:114965635-114965657 TGGTATTTTTTTCTAATGTTTGG + Intronic
1074649205 10:115500364-115500386 TTTTATTATTTTCTAAGGTTTGG - Intronic
1075101404 10:119508923-119508945 AAATATATTTTTCTAGGGATGGG - Intronic
1079164415 11:18025780-18025802 CAATATTTTATTCTAATGATCGG + Intronic
1079183718 11:18216901-18216923 TAATATTTTTCTCTAGGTTTGGG - Intronic
1079744146 11:24103829-24103851 TAAGATTTTTTTTTCAGGTTCGG - Intergenic
1079970442 11:27029982-27030004 ACATATTTTATTCAAAGGTTAGG - Intergenic
1080069210 11:28059120-28059142 CAATATTGTTTTCTTAGGGTTGG + Exonic
1080134583 11:28839825-28839847 GAGTTTTTTTTTCTAAAGATAGG - Intergenic
1080289881 11:30658879-30658901 GAATATTTTATTCTAATATTTGG - Intergenic
1080803220 11:35628168-35628190 GAAAATCTTTTTCAAATGTTTGG - Intergenic
1081304081 11:41490162-41490184 GAATAATTTTTTGAAAGGTCAGG + Intergenic
1081648963 11:44810531-44810553 GAATATTTATTTCTATCTTTTGG + Intronic
1083024118 11:59535387-59535409 GAATCTGTATTTCTAAGGCTGGG + Intergenic
1084386327 11:68844769-68844791 GTTAATTTTTTTCAAAGGTTTGG - Intergenic
1086491795 11:87363235-87363257 GAATCTTTTGTTCTAATATTTGG - Intergenic
1086558840 11:88144009-88144031 GAAAATTGTTTTCTGAAGTTGGG - Intronic
1086989310 11:93285786-93285808 CAATATTTTTTTCTAAAAATTGG - Intergenic
1087435230 11:98108156-98108178 AAAAATTTTTTTTTAAAGTTAGG - Intergenic
1087570271 11:99918722-99918744 GAATTTCCTTTTCAAAGGTTTGG + Intronic
1087598207 11:100281620-100281642 TAATATTTTTCTCTAGGTTTGGG + Intronic
1087733804 11:101809231-101809253 AAATAATTTTTTTAAAGGTTGGG + Intronic
1090043182 11:123308635-123308657 CAATATTTTTTTGTATGGTGAGG - Intergenic
1090641765 11:128735433-128735455 GGCTTTTTATTTCTAAGGTTTGG + Intronic
1091019826 11:132088909-132088931 GATTTTTTTTTTTTAAGATTTGG + Intronic
1091576850 12:1744980-1745002 TTAAATTTTTTTTTAAGGTTCGG + Intronic
1092450551 12:8597823-8597845 GAGTAACTTTTTCTGAGGTTGGG + Intergenic
1092504887 12:9088273-9088295 GAATATATTTTTGTAAAATTAGG + Intronic
1092802115 12:12179223-12179245 AAATATTTTTTCCCAAGCTTTGG + Intronic
1092993266 12:13923991-13924013 GAATATTTTCTTCTCAGTTTTGG + Intronic
1093097808 12:14991897-14991919 GAACATTTTTATTTTAGGTTTGG - Intergenic
1093277418 12:17147155-17147177 AAATATTTTTTTCTAAGCTCAGG + Intergenic
1093400056 12:18734844-18734866 AAAGATTTTTTTCTAAGATCTGG - Intronic
1093563107 12:20566514-20566536 GTATTTTTTTTTTTAAGTTTAGG + Intronic
1093618622 12:21259616-21259638 AAATCCTTTTCTCTAAGGTTGGG - Intergenic
1093641430 12:21530943-21530965 AAATCTTTTTTTCTCAGCTTGGG - Intronic
1093659572 12:21738320-21738342 GAATAATTGTTACTAGGGTTGGG - Intronic
1093989247 12:25571656-25571678 AAATATTTTTTGAAAAGGTTGGG - Intronic
1094033451 12:26040452-26040474 AAGTATTTTGTTCTAAAGTTTGG + Intronic
1094120231 12:26966108-26966130 GAATTTTTTTATCTTAAGTTTGG + Exonic
1094152460 12:27300636-27300658 GATTATTCTTGTCTAAGGGTTGG + Intronic
1094201461 12:27798764-27798786 GAATATTTTTATGCAAGTTTTGG - Exonic
1094303672 12:28994320-28994342 CCAAATTTTTTTTTAAGGTTTGG - Intergenic
1094314847 12:29128426-29128448 TAATTTTTTTTTCTAATGTTTGG + Intergenic
1094603530 12:31931401-31931423 GAATAATTCTTTCTCAGGCTGGG + Intergenic
1095655435 12:44663244-44663266 GCTTATTTTTTTTTAATGTTAGG - Intronic
1095656562 12:44676687-44676709 GAATATATTATTCTTAGCTTTGG + Intronic
1095668664 12:44833610-44833632 GAATTTTCTTTTCCAAGGCTTGG + Intronic
1095753168 12:45731673-45731695 GAAAATTTTTTTCTTTGTTTTGG + Intronic
1096026310 12:48366083-48366105 GATTCTTTTTTTCTTAGTTTTGG + Intergenic
1096894012 12:54801803-54801825 GAATCTTTGTTTCTGAGGCTTGG + Intergenic
1096930735 12:55206272-55206294 GAAAGTTTTTTTCTAAGATCTGG + Intergenic
1097541214 12:60946034-60946056 GAATCTTTTGTTCTAATATTTGG + Intergenic
1097574572 12:61375393-61375415 GAATATTTTTTCCTAATGCAAGG + Intergenic
1097608986 12:61794114-61794136 GAACATTTTTTTCTAAAATCAGG + Intronic
1097806089 12:63966658-63966680 GAATATCTTTTTCTTAATTTAGG + Intronic
1098157868 12:67618818-67618840 GAATCTTTTGTTCTAATATTTGG - Intergenic
1098835642 12:75421444-75421466 GAATATATATTTCTTAGGCTTGG + Intronic
1099135026 12:78886679-78886701 GAATAATGTTTTGAAAGGTTTGG + Intronic
1099289935 12:80764049-80764071 GATTTTTTTTTTTTAAGGTTGGG - Intergenic
1099328110 12:81245575-81245597 GAATAGTTTCTTTTAAGGGTAGG + Intronic
1099595841 12:84664702-84664724 GATTATTTTTGTGTATGGTTTGG - Intergenic
1099629684 12:85126594-85126616 GAATATTTTTTTCAAAGTACTGG + Intronic
1099967633 12:89467062-89467084 CAATATCTTTTTTTAAGGTGTGG + Intronic
1100100984 12:91105512-91105534 CAATGTTTTTTTCTAATATTAGG - Intronic
1100873949 12:98942822-98942844 CAATATTCTTTTTTGAGGTTTGG - Intronic
1101146671 12:101847039-101847061 TAATTTTTTTTTCTAGGGATGGG - Intergenic
1101505970 12:105346516-105346538 TAAGATTTTTTTTTAAGTTTAGG + Intronic
1101546646 12:105719636-105719658 AAAAATTTTTTTTTAATGTTTGG - Intergenic
1101729323 12:107413666-107413688 GAAGATTATTTTATAAGTTTGGG + Intronic
1102090303 12:110181769-110181791 TCATATTTTTTTCTTAAGTTGGG + Intronic
1102855776 12:116292077-116292099 CAATATATATTTCTTAGGTTAGG - Intergenic
1105373577 13:19822043-19822065 GATTTTTTTTTTCTAAGGGTTGG + Intergenic
1105621891 13:22075968-22075990 GATTTTTTTTTTTTAAGTTTGGG + Intergenic
1105712336 13:23024080-23024102 GAATATTTGTTTATAATTTTGGG - Intergenic
1105940489 13:25142974-25142996 GAACATTTTTTTCTTAAGTAGGG + Intergenic
1106378518 13:29213089-29213111 GAATCTTTTGTTCTAACATTTGG - Intronic
1106392517 13:29348309-29348331 GAATCTTTTGTTCTAACATTTGG - Intronic
1106496315 13:30280218-30280240 TATTTTTTTTTTTTAAGGTTCGG - Exonic
1106968689 13:35107343-35107365 GAAAATTATGTACTAAGGTTTGG + Intronic
1107745431 13:43501992-43502014 GAATCTTTTTTTCTTAGTCTGGG - Intronic
1108423569 13:50275018-50275040 GATTATTATTTTCTATGATTTGG + Intronic
1108533158 13:51346264-51346286 GAATATTGTTTTCTAAGCAAAGG + Intronic
1108583845 13:51850576-51850598 CAATAATTTTTTCTCAGGTGGGG + Intergenic
1108606149 13:52040525-52040547 GACTATATTTTTCTTATGTTTGG + Intronic
1109180690 13:59211020-59211042 GAATATTTCTTTCTTCAGTTGGG + Intergenic
1109249157 13:59997571-59997593 GACTGTTTTTTTCTAACCTTTGG + Intronic
1109498014 13:63200280-63200302 GAATCTTTTGTTCTAATATTTGG + Intergenic
1109679887 13:65737081-65737103 GAATATTTTCTTCAAAAGTCTGG + Intergenic
1110062388 13:71058701-71058723 GAATATTTTCCTCTAAGATTAGG - Intergenic
1110096684 13:71532917-71532939 GAATATATTTTTCTAATTATGGG + Intronic
1110203966 13:72889069-72889091 TAATATTTATTTGTAATGTTTGG + Intronic
1110204832 13:72900232-72900254 GAATTTTTTTTTCTAACTCTGGG - Intronic
1110261758 13:73492709-73492731 AAATATTTTTTTCTAAAGGTAGG - Intergenic
1111044299 13:82794950-82794972 GAATATTTTGTTTTTAGTTTGGG - Intergenic
1111062182 13:83035823-83035845 AAATCTTTTCTTCTAAAGTTAGG + Intergenic
1111128187 13:83939609-83939631 AATAATTTTTTTCTAAGATTAGG + Intergenic
1111588776 13:90316371-90316393 GAATTTCTTTTTCTAAGGCCAGG + Intergenic
1111789447 13:92835156-92835178 GAATAATTTTTTCAAAGCCTAGG + Intronic
1111933955 13:94540313-94540335 GAATATGTTTTTCTAACACTTGG - Intergenic
1112147282 13:96714150-96714172 CAATGTTTTCTTTTAAGGTTTGG - Intronic
1112796424 13:103061419-103061441 CAATATTTTTTTCTAGAGTGTGG + Intronic
1113369583 13:109710878-109710900 CAATATTGTTTTTTAAGTTTTGG - Intergenic
1114754095 14:25239325-25239347 AATTACTTTTTTCTAAGGCTTGG + Intergenic
1114824156 14:26056811-26056833 GAATAATATTTTCTAACTTTGGG - Intergenic
1114931209 14:27469693-27469715 CAATTTTTTTTTCTAAAATTTGG - Intergenic
1116012637 14:39368599-39368621 GAATTTTTTTTTTTAATCTTTGG + Intronic
1116151859 14:41152490-41152512 TAATGTTTTGTTCTAACGTTTGG + Intergenic
1116291192 14:43043587-43043609 GAGTGTTTTTTTCTGAGCTTTGG - Intergenic
1116304585 14:43234484-43234506 TAGTATTTTTTTTTAAGTTTTGG + Intergenic
1117110513 14:52448155-52448177 TGATATCTTTTTCTAAGTTTGGG - Intronic
1117241759 14:53840760-53840782 GCAAATTTTTTTCTTAGTTTAGG + Intergenic
1117937833 14:60926994-60927016 GAATCTTTTGTTCTAATATTTGG - Intronic
1118369367 14:65124334-65124356 AAAAATTTTTTTTCAAGGTTTGG + Intergenic
1118526230 14:66647075-66647097 TAATATTTTTTTTTAAAGTCAGG + Intronic
1119791941 14:77358853-77358875 GTGTATTTTTTTCTAAGATGGGG - Intronic
1119822280 14:77627566-77627588 GAATGCTTTCTTCTAAGATTAGG + Intergenic
1120482524 14:85069892-85069914 GAATGTTTTTTTCTAAGATAAGG - Intergenic
1120482525 14:85069918-85069940 GAATGTTTTTTTCTAAGATAAGG - Intergenic
1120734603 14:88038956-88038978 AAACATTTTCTTCTAGGGTTTGG + Intergenic
1122053532 14:99076460-99076482 GACTATTTTTTTATGTGGTTGGG + Intergenic
1123595805 15:21911307-21911329 GCCTATTTTTTTCTAAGGACAGG + Intergenic
1124192755 15:27594747-27594769 GAATCTTTTGTTCTAATATTTGG - Intergenic
1124682400 15:31745750-31745772 GAATATTTTTTTCTCATTTGGGG - Intronic
1125059143 15:35398158-35398180 GAATCTTTTGTTCTAACATTTGG + Intronic
1125272477 15:37954172-37954194 TGATATTTTTCTCTAAGTTTGGG - Intronic
1125426435 15:39553839-39553861 GAATATTGATTTAGAAGGTTTGG - Intergenic
1125901124 15:43348833-43348855 GAGTATTTTTTTCTATAGCTAGG - Intronic
1126136471 15:45397183-45397205 GAATCTTTGGTTCTAATGTTTGG + Intronic
1126187232 15:45841984-45842006 GCATCTTTTGTTCTAATGTTTGG - Intergenic
1126467024 15:48970305-48970327 GAATAGTTTTTTCTAATTCTGGG - Intergenic
1126995050 15:54433194-54433216 GAATCTCTTTTTCTATTGTTTGG - Intronic
1127094053 15:55495287-55495309 GAATTTATTTTTCTAAGATCGGG - Intronic
1127304655 15:57693107-57693129 AGATATTTTATTTTAAGGTTGGG - Intronic
1127447052 15:59074057-59074079 GAATATTTTTTTCTTAGTAGTGG + Intronic
1127543156 15:59963318-59963340 AAATATTTTTTTCTAGAGATAGG - Intergenic
1128096854 15:64963301-64963323 GAATGTTAATTTCTGAGGTTTGG - Exonic
1128285479 15:66433246-66433268 CAATATTTTCATCCAAGGTTCGG - Intronic
1128573002 15:68749317-68749339 GAATACTTTCTTCTAAGATTGGG + Intergenic
1129075742 15:72994406-72994428 CTATATTTTTTTCTGAGTTTAGG - Intergenic
1130524304 15:84690608-84690630 GAATATTTTTTTTAAAGATGGGG - Intronic
1130828504 15:87574743-87574765 AACTATTTTTTTTTAAGTTTTGG - Intergenic
1131155389 15:90072194-90072216 GAACTTTCTTTTCTACGGTTTGG - Intronic
1132763252 16:1521392-1521414 ATATATTTTTTTCTGAGGTGGGG + Intronic
1133884947 16:9818019-9818041 GACTTTTTTTTTTTAAGGCTCGG + Intronic
1133905557 16:10018970-10018992 AAATATTTTTTCTTGAGGTTTGG - Intronic
1135148217 16:19982207-19982229 GGATAATTTTTGCTAAGGTTGGG + Intergenic
1140142100 16:72267884-72267906 AAATATTTTTTTTTAAGTTGTGG + Intergenic
1140324182 16:73984690-73984712 CAATATTTTTTTTTAATCTTTGG - Intergenic
1140392447 16:74599169-74599191 TAATATTTTTATCTGAGGTAGGG + Intronic
1140596762 16:76425043-76425065 CAAAATTTTTTACTGAGGTTTGG - Intronic
1140874028 16:79133837-79133859 AAATGTTTTTTTCAAAGGCTTGG + Intronic
1140954683 16:79851423-79851445 GAATATTTTTATCCAATGTTTGG + Intergenic
1141095963 16:81163417-81163439 GATTTTTTTTTTTTAAGTTTTGG - Intergenic
1143546618 17:7600486-7600508 GAATATTTATTTTTTAGGGTGGG - Intronic
1143694265 17:8599714-8599736 GAAAATTTATTGCTAATGTTAGG + Intronic
1143769676 17:9160655-9160677 AAATATATATTTCTTAGGTTGGG + Intronic
1144169812 17:12648868-12648890 GAATATTTTATTCTAAAGCATGG - Intergenic
1146108727 17:30067745-30067767 AAATCTTTTTTTCTAAGATCTGG + Intronic
1146147619 17:30434978-30435000 GATTATTTTTTGCTAATGGTAGG - Intronic
1146402947 17:32514482-32514504 GAATAGTGTTTTTTAAAGTTTGG - Intronic
1149149224 17:53539230-53539252 AAAGATTTTGTTCTATGGTTAGG + Intergenic
1149418254 17:56482954-56482976 TATTATTTTTTTCTCTGGTTGGG - Intronic
1149454942 17:56780276-56780298 TAATTTTTTTTTTTAATGTTAGG + Intergenic
1149720811 17:58842137-58842159 GAATTTGTTTTTCTCAGGCTGGG - Intronic
1150204395 17:63391178-63391200 GAACATTTCTTTTTTAGGTTAGG - Intronic
1150305633 17:64082849-64082871 GATTTTTTTTTTCTAGGCTTAGG + Intronic
1150392047 17:64795790-64795812 GCATCTTTTTTTATAAAGTTGGG - Intergenic
1151056231 17:71034679-71034701 TAATATGTTATTCTAAGGTAAGG - Intergenic
1151150334 17:72079680-72079702 GAATATTTTTTGTTCATGTTTGG + Intergenic
1153440692 18:5116280-5116302 GTATATTTGTTTATATGGTTTGG + Intergenic
1155743252 18:29316768-29316790 GAAAATTTTCTTTTAAGGTCAGG + Intergenic
1155830115 18:30505526-30505548 AAATAGTTTTTTGTAACGTTTGG - Intergenic
1156271197 18:35533927-35533949 GAAAATTTTTATCTTGGGTTAGG + Intergenic
1156829975 18:41480204-41480226 CAATAGTTTTATCCAAGGTTTGG + Intergenic
1157046920 18:44112307-44112329 CAAGATTTTTTTCTTAGTTTTGG + Intergenic
1157270061 18:46267449-46267471 GAATAATTTTTTCCATAGTTTGG + Intergenic
1157381755 18:47224918-47224940 AAAAATTTTTTTTTAAGTTTTGG - Intronic
1157866488 18:51190783-51190805 GAAAATAATTTTCTAATGTTAGG - Intronic
1158133236 18:54176401-54176423 CAGAATTTTTTTCTAATGTTAGG + Intronic
1158787181 18:60728424-60728446 GAACATTTTTTTCTATGTTTTGG + Intergenic
1158856592 18:61548932-61548954 TAATAATGTTTTCTTAGGTTAGG + Intronic
1159068806 18:63599427-63599449 GAATATTTATTTCTATGAGTTGG - Intronic
1159131812 18:64288383-64288405 GAATCTTTTCTTCTAATATTTGG + Intergenic
1159593197 18:70357027-70357049 GAATATTTGTTCCTCAGCTTTGG + Intergenic
1163519849 19:17785516-17785538 AAATATTTTTTTGTAAGGCTGGG - Intronic
1164755888 19:30689192-30689214 GAACATTTTGTTCTCAGCTTTGG - Intronic
1165268381 19:34681060-34681082 GAATTTACTTTTCTCAGGTTTGG - Intronic
1165559317 19:36665756-36665778 GATTTTTTTTTTCTGAGATTTGG - Intronic
1166175807 19:41068769-41068791 GAATCTATTGTTCTAATGTTTGG + Intergenic
1166187421 19:41150206-41150228 GAATTTTTTTTTCTTAGAGTTGG + Intergenic
1166514759 19:43438051-43438073 TAAAATTTTTTTCTAGAGTTGGG - Intergenic
1168370984 19:55833974-55833996 AATTATTTTTCTCTAAGGTAGGG - Intronic
1168486967 19:56771667-56771689 AAATATTTTTTTCTATGTGTAGG - Intergenic
925663700 2:6230525-6230547 GAACATTTATGACTAAGGTTTGG - Intergenic
926160292 2:10483012-10483034 GAATTTTTTGTTCTAACATTTGG - Intergenic
926769463 2:16355781-16355803 GAATATATTTGTTTAAAGTTTGG + Intergenic
926819276 2:16834951-16834973 GAATATTTTTTTGTAGAGATGGG + Intergenic
927040437 2:19225127-19225149 GCTTATTTTTTTATAAGATTTGG + Intergenic
927398160 2:22679719-22679741 AAATGCTTTTTTCTAAGATTGGG - Intergenic
927537825 2:23877882-23877904 AAAAATTTTTTTGTAAAGTTGGG - Intronic
928609738 2:32981107-32981129 GGATATTTTTCTCTAGGTTTGGG + Intronic
928827083 2:35436014-35436036 AAATATATTTTTTTAATGTTTGG + Intergenic
929640800 2:43577616-43577638 TAATATATTTTTCTAAGGTCAGG + Intronic
929846246 2:45531607-45531629 AAATATTTTTTTCTTAAGTTGGG + Intronic
931293892 2:60903360-60903382 GAATTTCTTTTTCTTAGTTTTGG + Intronic
931461670 2:62455361-62455383 GAACATTTATTTCTAGGTTTGGG + Intergenic
931578614 2:63748314-63748336 AAATAATTTTATCTAAGATTAGG - Intronic
932227210 2:70051800-70051822 TAAAATTTTTTTCTAAAGATGGG - Intergenic
932518774 2:72384432-72384454 AAATCTTTTTTTTTAAGATTAGG + Intronic
933138588 2:78764654-78764676 AAATATTTTGTTCTAAAGTAAGG - Intergenic
933293307 2:80461673-80461695 GACTTTTTTTTTTTAAGTTTCGG - Intronic
935480645 2:103584600-103584622 AAATATTTTTGACTAAGGCTTGG - Intergenic
935493620 2:103751399-103751421 AAATATTTTTTCCTGTGGTTTGG + Intergenic
935511330 2:103978995-103979017 CAATATTTATTTCTTAGGTTTGG + Intergenic
936002518 2:108847980-108848002 GTGTATTTTTTTTTAAGATTTGG - Intronic
936492924 2:112989545-112989567 GAAGCTTTTATTCTAAGATTTGG - Intergenic
937698999 2:124841950-124841972 GAAGGTTTTTTTTTAAGTTTTGG - Intronic
939355365 2:141094633-141094655 GAATATTCTTCTCTAAGATGTGG + Intronic
939614611 2:144348311-144348333 GAATTTTTTTGGCTTAGGTTGGG + Intergenic
939888574 2:147708225-147708247 AAATGTTTTTTTCCAAGCTTGGG + Intergenic
940947200 2:159631020-159631042 TAAAATTTTTTTGTAAAGTTGGG - Intergenic
941107202 2:161368410-161368432 GAATATTTTTTTCCCAGGCATGG + Intronic
941148650 2:161886334-161886356 AAATAATTTTTTTTAAGGATGGG - Intronic
941298997 2:163777458-163777480 GGATATTATTTTCTCAGTTTTGG + Intergenic
941798257 2:169625726-169625748 CAATTTTTTTTTTTAAGGTTAGG + Intronic
942240033 2:173953833-173953855 GATTATTTTTTTTTAGGGGTTGG - Intronic
942413180 2:175732785-175732807 GACTATTTTTTTTTTAAGTTCGG - Intergenic
942792504 2:179776523-179776545 GAAGATTTTTTTAAAAGGTGCGG - Intronic
943619371 2:190131102-190131124 GAATCTTTTGTTCTAATATTTGG + Intronic
945141160 2:206687466-206687488 GAAAATATTTTTCTAAGTCTAGG + Intronic
945578760 2:211565864-211565886 GACTTTTTGTTTCTGAGGTTTGG + Intronic
945605214 2:211921079-211921101 CAAGATTTTTTTTTAAAGTTTGG - Intronic
945893749 2:215459070-215459092 AAACATTTTTTTAAAAGGTTGGG + Intergenic
947085916 2:226452759-226452781 GAATTATTTTTTATAAGTTTTGG - Intergenic
947253707 2:228137670-228137692 TAATTTTTTTTTCTAGTGTTGGG - Intronic
947515374 2:230799659-230799681 AAATATTTATTCATAAGGTTAGG - Intronic
947545364 2:231006779-231006801 GAATTTTCTTTCCTAAAGTTTGG + Intronic
948072449 2:235138723-235138745 TAATATTTTATACTAAGGGTTGG + Intergenic
948083532 2:235227147-235227169 GAATCTTTTGTTCTAATGTTTGG - Intergenic
948342488 2:237265683-237265705 AAATCATTTTTTCTATGGTTTGG - Intergenic
948582598 2:238998114-238998136 GATTATTATTTCCTAAGGGTAGG - Intergenic
948759036 2:240179248-240179270 GTGCATTTTATTCTAAGGTTGGG - Intergenic
1168744278 20:223651-223673 AAAGATTTTTTTTTAAGATTAGG - Intergenic
1170166263 20:13362917-13362939 GAATCTTTTGTTCTAATATTTGG + Intergenic
1170166279 20:13363001-13363023 GAATCTTTTGTTCTAATATTTGG + Intergenic
1170551138 20:17477423-17477445 GAATATTTTTTTCTTAAATCAGG + Intronic
1170685509 20:18566219-18566241 GAATATTTTATTCTGTGGCTTGG + Intergenic
1171206468 20:23285436-23285458 AAATATTTTTTTCTAATTCTGGG + Intergenic
1171332508 20:24353042-24353064 TAATTTATTTTTCTAAGTTTTGG + Intergenic
1173061318 20:39664442-39664464 GAATCTTGTCTTCTAATGTTTGG + Intergenic
1173509266 20:43613448-43613470 AAAAAATTTTTTCTAAGCTTTGG - Intronic
1173740614 20:45398284-45398306 TAATAATTTTTTCTAATGTTGGG - Intronic
1174648085 20:52103340-52103362 GTACATTTTTTACGAAGGTTGGG - Intronic
1174839468 20:53887916-53887938 GAATATTTTTCTCTTGGGTTTGG + Intergenic
1176872430 21:14094416-14094438 AAATATTTTTTTTTTAGGCTGGG + Intergenic
1177306854 21:19329592-19329614 GAATATTTATTTTAAAGTTTGGG + Intergenic
1177308930 21:19361115-19361137 AACTATTTTTTTCTAATATTTGG + Intergenic
1177351580 21:19949818-19949840 GAATTTTATTATCTAATGTTAGG + Intergenic
1177591965 21:23183163-23183185 GAATACTTTGTTCTAATATTTGG + Intergenic
1177593552 21:23205429-23205451 AAATATGTTTTTCCAAGCTTCGG + Intergenic
1177825096 21:26074072-26074094 AAATATATTTTTTGAAGGTTTGG - Intronic
1178032388 21:28542725-28542747 GAATCTTTTGTTCTAATGTTTGG + Intergenic
1178192467 21:30300396-30300418 GAACATTTATTTTTAAAGTTTGG + Intergenic
1178313460 21:31549826-31549848 GAATATTTTTTTAAAAGGCCGGG + Intronic
1178672905 21:34607660-34607682 TAAGATTTCTTTCTAAGGCTGGG - Intronic
1179119925 21:38534290-38534312 CAATTTTTCTTTTTAAGGTTTGG + Intronic
1182924844 22:34112469-34112491 GAATATTTTTTTCTTGGGAGGGG - Intergenic
1182964328 22:34507108-34507130 TAAAATGTTTTTCTAAGTTTGGG - Intergenic
949914053 3:8943044-8943066 GTATAATGTTTTCTTAGGTTAGG - Intronic
950986244 3:17371282-17371304 GAATATTTTATTGTATTGTTAGG + Intronic
951406105 3:22299845-22299867 CAATATTTTTTTCTAATCTACGG - Intronic
951584444 3:24201122-24201144 GATTTTTTTTTTTTAAGTTTAGG + Intronic
951636902 3:24789110-24789132 AAAAATTTTTTTCTAAGGCTTGG + Intergenic
952040299 3:29253440-29253462 GACTTTTTTTTTTTAAGCTTAGG + Intergenic
952461421 3:33530301-33530323 TAATTTTTTTTTGTAAAGTTAGG - Intronic
952529795 3:34251733-34251755 GAAACTTATTTTCTAGGGTTGGG - Intergenic
952780603 3:37093415-37093437 GATTATTATTTTCTTTGGTTGGG - Intronic
953226045 3:41022330-41022352 GCATATATATTTCTAAAGTTTGG - Intergenic
953273180 3:41466721-41466743 GAATATTTTTTCCTATTCTTTGG - Intronic
953364805 3:42335086-42335108 TAAAATTTTTTTGTAGGGTTGGG - Intergenic
953886821 3:46718762-46718784 AAATATTTTTTTCTAAGGTACGG + Intronic
954961924 3:54573609-54573631 GCATATATTTTTGCAAGGTTGGG + Intronic
955336264 3:58088747-58088769 GCATAGTTTTTTCTATGGTGTGG - Intronic
955551903 3:60094070-60094092 CAATATTTTTTTTTAAATTTTGG - Intronic
955926801 3:64014681-64014703 GAATATTTGTTTTTAGTGTTGGG + Intronic
956489770 3:69758340-69758362 AATTTTTTTTTTCTAAGGTTGGG + Intronic
956676844 3:71742548-71742570 GAATTTTTTTCTTTAATGTTTGG - Intronic
956819145 3:72937092-72937114 GTATATTATTTACTAAGTTTTGG + Intronic
958682656 3:97352157-97352179 GGATATTTTTTTTTAATGATTGG + Intronic
958821230 3:98976058-98976080 GAATTTTTTTTTTTAAGTTCTGG - Intergenic
958882436 3:99688041-99688063 GAACATTTTATTCCAATGTTTGG - Intronic
959396529 3:105845806-105845828 GAATAGACTTTTCTAAAGTTTGG - Intronic
959399808 3:105886187-105886209 GAATAGCTATTTCTGAGGTTGGG - Intergenic
959436827 3:106325569-106325591 GAATTTTTTTTCCTTTGGTTTGG - Intergenic
959619129 3:108381139-108381161 GAATGGTTTTTACTAAAGTTAGG - Exonic
959882376 3:111459157-111459179 GAATATTTTTATCTTGGTTTTGG + Intronic
960536133 3:118816282-118816304 GAACATTATTTTCTAAGGCAGGG - Intergenic
960836545 3:121912614-121912636 GAACATTTTTTTTTAAATTTTGG + Intronic
960923845 3:122777569-122777591 GAACATTTTATTGGAAGGTTTGG - Intronic
961684289 3:128618592-128618614 GAATGTTCTACTCTAAGGTTGGG - Intergenic
962038594 3:131681657-131681679 TGATATCTTTTTCTAAGTTTGGG + Intronic
962182367 3:133221416-133221438 GAATCTTTTGTTCTAATATTTGG - Intronic
963874412 3:150458160-150458182 GAATTTTCTTTTCAAAGTTTGGG - Intronic
965149753 3:164955834-164955856 GTATATTATTTTCTAAATTTTGG + Intergenic
965222759 3:165949096-165949118 GAATGTTTTTTTTTCAAGTTTGG + Intergenic
965232094 3:166067840-166067862 GAATATTTTCCTCTCAGGTTTGG + Intergenic
965238894 3:166166889-166166911 GTATTTTTTTTTTTAAGATTTGG + Intergenic
965287582 3:166837149-166837171 GAATCTTTGTTTCTAGTGTTTGG + Intergenic
965561205 3:170063766-170063788 GAATATATTTTTAAAAGATTGGG + Intronic
966496107 3:180582770-180582792 AAATTTTTTTTTCTTAGGTTGGG + Intergenic
966981447 3:185139804-185139826 GAGTAATTTTTTATAAGGTGTGG - Intronic
967510529 3:190305877-190305899 TAAAATTTTTTTGTAATGTTTGG + Exonic
967842440 3:194017534-194017556 GAATATTTTCTTATATGATTGGG + Intergenic
968179132 3:196577964-196577986 GATTTTTTTTTTTTAATGTTAGG + Intronic
969098088 4:4749415-4749437 GACCATTTTTTTTCAAGGTTGGG + Intergenic
970707712 4:18824382-18824404 AAATATTTTTTTCTAAGAACAGG + Intergenic
971051122 4:22863806-22863828 GAACATTTTTTATTAATGTTAGG - Intergenic
971843609 4:31889554-31889576 GCATTTTTTTTTTTTAGGTTTGG - Intergenic
972024635 4:34361748-34361770 TAATTTTTTGTTTTAAGGTTTGG + Intergenic
972375714 4:38468159-38468181 GAAGATTTTATTCACAGGTTGGG + Intergenic
972599323 4:40557741-40557763 CAATTTTTTTTTTTAAGGTGGGG - Intronic
973078362 4:45959580-45959602 GATAATTTTTTTCTAAACTTAGG - Intergenic
973711999 4:53639415-53639437 GAAGAATTTTTTTTTAGGTTTGG - Intronic
973925913 4:55737184-55737206 GAATCTTTTTACCTAAGGATGGG + Intergenic
974093828 4:57340141-57340163 TAATGTTTGTTTCTAAAGTTAGG - Intergenic
974120812 4:57636613-57636635 GATTATTTTTTCCTAAGTTTAGG + Intergenic
974131562 4:57762564-57762586 AAATATTTTTTTTCAAGGGTGGG + Intergenic
974189407 4:58484807-58484829 GAGAATTTTTATCTATGGTTAGG + Intergenic
974514449 4:62890817-62890839 GAATTTTTTTTTTTAAGTTCTGG - Intergenic
975018138 4:69450160-69450182 GAATAGTTTCTTATAAGGATTGG - Intergenic
975245265 4:72113253-72113275 GAAATTTTTTTTCTTAGGATTGG + Intronic
975265773 4:72364887-72364909 CTATATTTTTTTCAAAGTTTTGG - Intronic
975295334 4:72727728-72727750 TAATATCTTTCTGTAAGGTTGGG - Intergenic
975458415 4:74620931-74620953 GAATATCTCTTTCAAATGTTAGG + Intergenic
975637008 4:76460524-76460546 GAATATTTTTTTCACAGTTCTGG + Intronic
976325740 4:83769751-83769773 TAACATTTTTTTCTAGGTTTGGG - Intergenic
976888681 4:90017077-90017099 GAAGCTTTTTATCTATGGTTAGG - Intergenic
977003847 4:91540480-91540502 GAATATTTTTTCCGAATGTGAGG + Intronic
977529943 4:98188985-98189007 GAATAATTCTTTCTTGGGTTTGG + Intergenic
978695892 4:111578539-111578561 GAATATTATTTCCTAGTGTTTGG - Intergenic
978831232 4:113087406-113087428 GAATACTTTATTGTAAAGTTTGG - Intronic
979316503 4:119271279-119271301 TAATTTTTTTTTTTAAGATTTGG + Exonic
979663368 4:123284164-123284186 AAATATTTTGTTTTAAGGTGGGG + Intronic
979759957 4:124390405-124390427 GTAATTTTTTTTCTATGGTTTGG - Intergenic
979880879 4:125958560-125958582 GAATATTTTTTTGTAGGATTTGG - Intergenic
979881074 4:125961320-125961342 CAATATTTTTTTGTTTGGTTTGG - Intergenic
980182608 4:129420225-129420247 GAATTTTTTTTTTTAAATTTTGG + Intergenic
980268011 4:130545188-130545210 GATTTTTTTTTTCAAAGATTAGG - Intergenic
980299896 4:130975867-130975889 AAATATTTTTTTCAAAGAATTGG - Intergenic
980499860 4:133635293-133635315 AAAAATTTTAATCTAAGGTTAGG + Intergenic
980635911 4:135502601-135502623 GAATAATTTTTTATAAGATTGGG - Intergenic
981230418 4:142347765-142347787 AAATATTTTTTTCTGAATTTAGG + Intronic
981261028 4:142719244-142719266 CATTAATTTTTTATAAGGTTAGG - Intronic
981291043 4:143075348-143075370 GAAGCTTTTTCTCTAAGATTAGG - Intergenic
981671331 4:147290531-147290553 GAATATTTTTGTATAGGTTTTGG - Intergenic
982111278 4:152057645-152057667 AAATCTTTTATTCTAAGATTAGG - Intergenic
982469005 4:155763536-155763558 GAATTTTTTTTTTGAAGGTAAGG - Intronic
982583254 4:157206019-157206041 TAATATTTCTTTCTAAATTTAGG + Intronic
982928941 4:161377146-161377168 GAATATTATTTTTTAAGTTTGGG - Intergenic
983399783 4:167247688-167247710 ACATATTTTTTTCTAACTTTAGG + Intergenic
983555366 4:169054825-169054847 GACAATTTTTTTGTAAGGGTGGG - Intergenic
984330862 4:178315955-178315977 GAATATTTTTATATAATGTCTGG + Intergenic
985158504 4:187019055-187019077 GAGTATTTTTTTAAAAGTTTAGG + Intergenic
985876027 5:2596023-2596045 GAATATTTATTTAAAATGTTTGG - Intergenic
986481028 5:8188396-8188418 TAATATTTCTTTCTAAGGGAAGG - Intergenic
986665496 5:10100254-10100276 GAATATTTTTCTTTAAAGTCTGG - Intergenic
986804085 5:11291941-11291963 GAATTTTTTTTTTTAAATTTAGG - Intronic
987083065 5:14442937-14442959 AAATATTTTGTTCTAAACTTTGG - Intronic
987110873 5:14685194-14685216 CAAAATTTTTTTGTAAGTTTTGG + Intronic
987113616 5:14710012-14710034 CAGTATATTTTTCTAAGTTTTGG - Exonic
987231603 5:15899516-15899538 CAAGATTTTTTTATAAGCTTTGG + Intronic
987415608 5:17658356-17658378 GAACATTTTTTTCATATGTTTGG + Intergenic
987464699 5:18258110-18258132 AATCATTTTTTTCTAAGATTGGG + Intergenic
987962481 5:24828125-24828147 GAATATCTTTTTCTATACTTTGG - Intergenic
988118081 5:26922192-26922214 TAATATTTTTTTCTAAATTTTGG - Intronic
988520108 5:31938032-31938054 AAATGTTTTTTTCTAAAGATCGG - Intronic
988619458 5:32808178-32808200 GATTTTTTTTTTTTAAGTTTTGG + Intergenic
988745122 5:34128047-34128069 GAAAAATTTTTTCTTGGGTTGGG + Intergenic
989084270 5:37658454-37658476 GAACATTATTTTCTAAGGCAAGG - Intronic
989126135 5:38054160-38054182 GAATCTTTTGTTCTAATATTTGG + Intergenic
989427993 5:41317974-41317996 TAATATCTTTCTCTAAGTTTGGG - Intronic
989439101 5:41449271-41449293 TAAAATTTTTTTCTGAGCTTTGG - Intronic
989560913 5:42849747-42849769 GAAGATTTTTTTTTAAAGTGTGG + Intronic
989572858 5:42961227-42961249 TAAGATCTTATTCTAAGGTTGGG + Intergenic
991274997 5:64835995-64836017 AAATATTTTCTTCTTGGGTTAGG - Intronic
991289071 5:65013675-65013697 AAATATTATTTTTTAAGCTTTGG + Intronic
991460788 5:66855988-66856010 TAATATTTTTTTCTAGAGATAGG - Intronic
991679371 5:69123740-69123762 GGATATTTTTGTTTATGGTTTGG + Intronic
991917059 5:71615776-71615798 GAATCTTTTGTTCTATGATTTGG + Intronic
992006216 5:72480318-72480340 GAATATTTTCTTGGAAGGTTTGG + Intronic
992375437 5:76183759-76183781 GAATATCATCTTCAAAGGTTTGG - Intronic
992684334 5:79184967-79184989 GAACATTGTTTTCTAAGCTGTGG + Intronic
992817563 5:80459540-80459562 AAATATATTTTTCAAAGGTTAGG - Intronic
993324725 5:86519221-86519243 GACTATTTTATTCTAAGTTCTGG + Intergenic
993419993 5:87689344-87689366 AAATCTTTTTCTCTAAGATTGGG - Intergenic
993715054 5:91268261-91268283 TAATATTTTGTTATAATGTTGGG + Intergenic
994738194 5:103584251-103584273 CAATAGCTTTTTATAAGGTTAGG + Intergenic
994869610 5:105330314-105330336 GCATAATTATTTCTAAGATTTGG + Intergenic
995654180 5:114406010-114406032 GAATATTTTTTTTTTAAATTTGG + Intronic
995996826 5:118310445-118310467 GATTATCATTTTCTAAGGTGTGG - Intergenic
996235993 5:121129448-121129470 GAAGATTTATTTCTGAGATTTGG - Intergenic
996448243 5:123583861-123583883 AAATTTTTTTTTGTAAAGTTAGG + Intronic
996983650 5:129532685-129532707 GAAAATTTATTTATAAGTTTTGG - Intronic
998221543 5:140286028-140286050 AAATATTTTTTTTTAAATTTCGG - Intronic
998913830 5:146993236-146993258 AAAAATTTTTTTCTAAGGCTAGG - Intronic
1000032522 5:157416632-157416654 GAATATTGTTTCTTCAGGTTGGG - Intronic
1000343102 5:160292732-160292754 TAATATTTTTTTCTATAATTTGG + Intronic
1000749737 5:165079184-165079206 GAATATCTTTTTTTAATCTTGGG + Intergenic
1000831341 5:166104786-166104808 AAATATTTTTTTATAAAGTAAGG + Intergenic
1001326423 5:170730757-170730779 GAATAGTTGATTCTAAGATTGGG + Intronic
1002151268 5:177233378-177233400 AAATTTTTTTTTTTAAAGTTTGG + Intronic
1003238231 6:4317736-4317758 GAATATTTTGTCCTAATATTTGG + Intergenic
1004422949 6:15487854-15487876 GAACATGTTTTTCTCAGGGTAGG + Intronic
1004434656 6:15578697-15578719 TAATATTTATTTCTTAGGATTGG + Intronic
1004507228 6:16256773-16256795 GAATCTTTTGTTCTAATATTTGG + Intronic
1004601067 6:17150388-17150410 AAATCTTTTGTTCTAATGTTTGG - Intergenic
1004801911 6:19157797-19157819 TAATTTTTTGTTCTAATGTTAGG - Intergenic
1004959248 6:20767743-20767765 GAACATTTATTTCTAATATTTGG + Intronic
1005037216 6:21567989-21568011 TGATATTTTTCTCTAAGCTTGGG + Intergenic
1005264386 6:24096160-24096182 GAATAGTTTTTTCTAGGGCCAGG + Intergenic
1005456421 6:26023986-26024008 GAATATATTTTTTGAAGGTAGGG - Intergenic
1005895433 6:30173333-30173355 GCAGATTTTTTTCAGAGGTTGGG - Intergenic
1007525084 6:42485020-42485042 AAAGATTTTTTTCTTAAGTTTGG + Intergenic
1008095401 6:47334740-47334762 GAATCTTTTGTTCTAATATTTGG + Intergenic
1008220518 6:48848790-48848812 GAATTGTTTTTTCTAACTTTGGG - Intergenic
1008692030 6:53990076-53990098 GAACATTTTTTTCTGAGATTTGG - Intronic
1009534955 6:64870215-64870237 GAATATTTATGTGTAAGATTTGG - Intronic
1009756736 6:67949650-67949672 GTATCTTTTTTTCTATTGTTTGG + Intergenic
1009898623 6:69783851-69783873 TAATATTTTTTTTTGAGATTGGG - Intronic
1009919828 6:70043668-70043690 AAATATTTTTTTCTAAGCAGTGG + Intronic
1010065183 6:71674146-71674168 GAATCTTTTGTTCTAATATTTGG - Intergenic
1010248931 6:73688335-73688357 GAATCTTTCATTCTAATGTTTGG + Intergenic
1010248937 6:73688417-73688439 GAATCTTTTGTTCTAATATTTGG + Intergenic
1010342625 6:74773284-74773306 GAAAGTTTTCTTCTAAGATTTGG - Intergenic
1011466007 6:87658105-87658127 GAACATTTTTCTCCTAGGTTAGG + Intronic
1011567545 6:88693231-88693253 GAATCTTTTTTTCTCAGTCTAGG - Intronic
1011914041 6:92479620-92479642 CAAGATTTTTTTCTTAGGTGGGG + Intergenic
1011943165 6:92868632-92868654 GTAGTTTGTTTTCTAAGGTTTGG - Intergenic
1011975898 6:93298151-93298173 TAATATTTTTTTCCAAGGCCAGG - Intronic
1012328657 6:97957177-97957199 AAATAGTTTCTTCTAAGGTCAGG + Intergenic
1012655204 6:101808532-101808554 GAATATTTGTTTCTAAGTACAGG + Intronic
1012832074 6:104216647-104216669 GAAAATTGTTTTCTATGCTTGGG - Intergenic
1013027755 6:106295039-106295061 GTATATTTTTTTTTAATTTTAGG - Intronic
1014595119 6:123326910-123326932 CAATATATTTTTCTAATGTGTGG + Intronic
1014731136 6:125032523-125032545 GAATATTATTTGCTAACATTTGG + Intronic
1014986435 6:128016661-128016683 CAATCTTTTTTTTTATGGTTAGG + Intronic
1015781580 6:136872892-136872914 GATTGTTTTTTTCAAAGGTATGG - Intronic
1015976759 6:138798456-138798478 GAATCTTTTGTTCTAATATTTGG - Intronic
1016251734 6:142050649-142050671 TAATATCTTTTTCTAGGTTTGGG - Intergenic
1016585839 6:145684151-145684173 GATTATTTTTTTCTTAATTTTGG - Intronic
1016624423 6:146149573-146149595 GTATTTTCTTTTCTAAGTTTTGG - Intronic
1017257059 6:152345575-152345597 GAATTTTTTTTTTTAAGTCTAGG + Intronic
1019718282 7:2552552-2552574 GTATTTTTTTTTTTAAGGATGGG - Intronic
1020613095 7:10425758-10425780 TAATATTTTTCTCTAGGTTTGGG + Intergenic
1020805853 7:12789766-12789788 AAATATTTTCTTTTAAGTTTTGG - Intergenic
1020989735 7:15182173-15182195 GAATGGTGTTTTCTTAGGTTTGG + Intergenic
1021198611 7:17700092-17700114 GAATATTTTCTCCTCAGGCTTGG - Intergenic
1021424458 7:20483912-20483934 GAATAATTTTTTCCAAATTTGGG - Intergenic
1021495317 7:21268087-21268109 GAATTTTTTTTTTTAATGTGAGG + Intergenic
1021723685 7:23530278-23530300 GAATTTTTTTTTACAAAGTTTGG - Intronic
1021796031 7:24255297-24255319 GAATATTTTTCTTTAATGTTGGG - Intergenic
1022868012 7:34442993-34443015 GAATTTTTTTTTTTAAGTTCTGG - Intergenic
1023389721 7:39697916-39697938 TACGAATTTTTTCTAAGGTTAGG + Intronic
1024856609 7:53788884-53788906 GAATATTTTTTATTAAGTTAAGG - Intergenic
1024896381 7:54266551-54266573 GAAGATTTTATCGTAAGGTTGGG + Intergenic
1026262617 7:68768623-68768645 GAAAATTTATTTCAAAGGATTGG + Intergenic
1027414324 7:77958877-77958899 GAATCTTTTCTTCTAATATTTGG - Intergenic
1027544735 7:79513268-79513290 GAAAAATTATTTCAAAGGTTTGG + Intergenic
1027586508 7:80065305-80065327 AAATATTTTTTTTTGAGTTTTGG - Intergenic
1027812264 7:82918861-82918883 CAATATTTTATTCTAATGTTTGG + Intronic
1028073208 7:86478030-86478052 GTATTTATTTTTATAAGGTTGGG - Intergenic
1028179782 7:87705528-87705550 AAATATTTTATTCTATTGTTAGG - Intronic
1028847880 7:95503191-95503213 GAATAATTTTTTTTAAAGTGTGG + Intronic
1029313035 7:99685521-99685543 AAATATTTTTGTGTAAGGTTGGG + Intronic
1029316665 7:99721907-99721929 AAATATTTTTGTGTAAGGTTGGG - Intronic
1029652317 7:101901882-101901904 AAATATTTATTTCTATTGTTTGG - Intronic
1030004708 7:105106007-105106029 GAATTTTTTTTTCAGAGTTTTGG + Intronic
1030032036 7:105378388-105378410 CAATATTTTTTTTAAAGGGTAGG + Intronic
1030117195 7:106070923-106070945 GAATATTTTTTTCTGAAATAAGG - Intergenic
1030473402 7:109997323-109997345 GAATATTTTCTCCTCAGTTTGGG + Intergenic
1030702157 7:112652705-112652727 GAAAATTTTTCTCTAAGACTAGG + Intergenic
1030872899 7:114779417-114779439 GAAATGTTTTTTATAAGGTTTGG - Intergenic
1030915944 7:115313619-115313641 GAATATTTTATAGTAGGGTTTGG - Intergenic
1030954593 7:115836462-115836484 GAAGATTTTATGCAAAGGTTAGG - Intergenic
1031353824 7:120766182-120766204 GAATATTTTGTTCTAATATTTGG - Intergenic
1031562621 7:123256299-123256321 GATAATTTTTTTGTAATGTTAGG + Intergenic
1031702037 7:124938165-124938187 GGATATTTTTTAATCAGGTTGGG + Intergenic
1032493506 7:132343105-132343127 GATTTTTTTTTTTTAAGGTTAGG + Intronic
1032986325 7:137341939-137341961 GAATATTTTTTTCTTCCTTTGGG - Intronic
1032999535 7:137488512-137488534 GTAGATTTTTTTTTAAGTTTTGG - Intronic
1033027658 7:137791770-137791792 GAATATTTTATTTTAGGGGTGGG + Intronic
1033079175 7:138279050-138279072 GAATCTTTTATTCTAATATTTGG + Intergenic
1033378182 7:140785135-140785157 GTATATTTTTGTCAAAGGTAGGG - Intronic
1033835690 7:145308776-145308798 AAATATTTTTCTCTAAGATCAGG + Intergenic
1035350606 7:158243365-158243387 GAATCATTTTTACTAGGGTTGGG - Intronic
1035876369 8:3194341-3194363 AAATATTTTTTTCTCAGTTTGGG - Intronic
1036043077 8:5107971-5107993 AAATATTTTTTTAAAAGGATTGG + Intergenic
1036095652 8:5722432-5722454 GAACATTTATTTCTAATTTTTGG - Intergenic
1036511944 8:9408634-9408656 TTATCTTTTTTTCTAAAGTTTGG + Intergenic
1037210931 8:16386748-16386770 GAAAACTTTTCTCTAAGATTAGG - Intronic
1037287261 8:17314701-17314723 TAATATGTTTTTCTTAGGTTGGG - Intronic
1037978892 8:23235883-23235905 AAAGATTTTTGTCTAAGATTAGG + Intergenic
1038820509 8:30947871-30947893 GAATCTTTTGTTCTAATATTTGG + Intergenic
1038865473 8:31434718-31434740 GAATCTTTTGTTCTAATATTTGG + Intergenic
1039113791 8:34069602-34069624 GTATACTTTTTTCCAAGGTCAGG + Intergenic
1039321055 8:36431892-36431914 GAATATTTTCTTCTAGTCTTCGG - Intergenic
1039347537 8:36724199-36724221 GAATTTTTTATTCTAGGGTAAGG + Intergenic
1040860651 8:51995563-51995585 TAATATGTTTTTTTAATGTTTGG + Intergenic
1040932415 8:52748791-52748813 GAATCTTTTGTTCTAATATTTGG - Intergenic
1040961744 8:53041409-53041431 AAATATTTTTTTCTAATTCTGGG + Intergenic
1041702639 8:60808329-60808351 GACCATTTTTTTTTAAAGTTGGG + Intronic
1042063476 8:64847062-64847084 GAATATATTATTTTGAGGTTTGG - Intergenic
1042468001 8:69150559-69150581 GAATATTTTTCTCTCTGGATTGG + Intergenic
1042588934 8:70375998-70376020 CATTATTATTTTCTAAGATTTGG + Intronic
1042634610 8:70860000-70860022 GAATATTTATTTCTATGTGTTGG - Intergenic
1042732524 8:71953089-71953111 GAGCATTTTTTTCTAGGCTTTGG + Intronic
1042950515 8:74196409-74196431 AAATATTTTTTTATATGTTTAGG - Intergenic
1043047568 8:75346849-75346871 GAGAATTTTTTTCTAAATTTAGG + Intergenic
1043088098 8:75862265-75862287 GAACATATTTTTCAAAAGTTAGG + Intergenic
1043136424 8:76532033-76532055 GATAATTTTTTTCCAGGGTTGGG - Intergenic
1043183863 8:77120178-77120200 GAATATTTTATGCTAGAGTTTGG - Intergenic
1043220011 8:77649759-77649781 GAATTTTTTTTAGTATGGTTTGG + Intergenic
1043277900 8:78423502-78423524 GAAACTTTTTTTCTAAGATCAGG - Intergenic
1043367062 8:79544797-79544819 TGATATTTTTCTCTAGGGTTGGG - Intergenic
1043492834 8:80766229-80766251 CAATATTTTTTTTTAATGTGGGG + Intronic
1044191393 8:89322577-89322599 GACATTTTTTTCCTAAGGTTTGG + Intergenic
1044372977 8:91435539-91435561 AACTATTTTTTTCCAAGTTTGGG + Intergenic
1044419857 8:91981941-91981963 CAAAATTTTTTTCTAATGATAGG - Intronic
1044536689 8:93365036-93365058 GAATGTTTCTTTCTAAAGATTGG + Intergenic
1044606782 8:94054692-94054714 GAATCTTTTGTTCTAATATTTGG - Intergenic
1045113181 8:98952714-98952736 AAATATTTTTTTCCAAGGGTGGG + Intergenic
1045584194 8:103512943-103512965 GAAATTTTTTTTTGAAGGTTAGG + Intronic
1045616325 8:103917089-103917111 TAATATTTATTGCTAATGTTTGG - Intronic
1046041655 8:108913269-108913291 ATATATTTTTTTCTAAAGTATGG - Intergenic
1046196645 8:110872684-110872706 GAATTTTTTTTACAAAGGTAAGG - Intergenic
1046383739 8:113482554-113482576 GAAAATTTTCCTCTAAGATTTGG - Intergenic
1046446850 8:114332581-114332603 GATTATGTTTTTCTAAATTTAGG + Intergenic
1046708482 8:117482342-117482364 AAATAATTTTTTCTAAAGATAGG - Intergenic
1046829891 8:118733066-118733088 GTATCTTTTTTTTTAAGTTTTGG - Intergenic
1047050977 8:121113068-121113090 GAATGTATTTTTCTGAAGTTTGG - Intergenic
1047129018 8:121997298-121997320 GAATATTTTTTATTAAAGTCAGG - Intergenic
1047175970 8:122540640-122540662 GCATATTTTTTTCTACACTTGGG - Intergenic
1047467268 8:125129148-125129170 GAATGTTTGTTTCTTAGGTGGGG + Intronic
1047572077 8:126110193-126110215 GAATATTTTGTTCTAATGTTTGG + Intergenic
1047917789 8:129601434-129601456 AAATCTTTCTCTCTAAGGTTGGG - Intergenic
1048940864 8:139399564-139399586 AAATATATTTTTCTAATTTTGGG - Intergenic
1049648152 8:143746233-143746255 AAGGATTTTTCTCTAAGGTTAGG - Intergenic
1049824607 8:144660683-144660705 GAATAATTTTTTAAAAGGCTGGG + Intergenic
1050274027 9:3977772-3977794 GAATATTTTTTTCTCCTCTTTGG - Intronic
1050648586 9:7749885-7749907 AAATATTTTTCTCTAAGATCAGG + Intergenic
1051792640 9:20825015-20825037 GATAATTTTTTTTTAATGTTTGG + Intronic
1052069525 9:24064986-24065008 GCATATTTTTTTCTAAAGATAGG + Intergenic
1052098862 9:24418364-24418386 GAATATATTTCACTAAGATTTGG + Intergenic
1052197454 9:25734416-25734438 TAATATTTTTTTCTGATGTCAGG - Intergenic
1052620699 9:30905468-30905490 GAATATTTTTTTCTATAATGAGG - Intergenic
1052816914 9:33108945-33108967 GAATCTTTTGTTCTAATATTTGG + Intronic
1052927894 9:34032626-34032648 GAATCTTTGTTTCTTAGGCTGGG + Intronic
1053559400 9:39174572-39174594 GAATATTTATTTGTATTGTTGGG - Intronic
1053566956 9:39263039-39263061 GAATATGCCTTTCTAAGATTAGG - Intronic
1053649667 9:40153197-40153219 CAATATTTTCTTCTAAGTATGGG - Intergenic
1053756084 9:41310750-41310772 CAATATTTTCTTCTAAGTATGGG + Intergenic
1053832731 9:42100881-42100903 GAATATGCCTTTCTAAGATTAGG - Intronic
1054130187 9:61355968-61355990 GAATATGCCTTTCTAAGATTAGG + Intergenic
1054137711 9:61444371-61444393 GAATATTTATTTGTATTGTTGGG + Intergenic
1054330179 9:63744960-63744982 CAATATTTTCTTCTAAGTATGGG - Intergenic
1054534914 9:66223007-66223029 CAATATTTTCTTCTAAGTATGGG + Intergenic
1054597822 9:67086529-67086551 GAATATGCCTTTCTAAGATTAGG + Intergenic
1055584647 9:77745335-77745357 GGAGATTTTCTTCAAAGGTTTGG - Intronic
1055836072 9:80443896-80443918 CAATATTTTTATCTAATGTATGG + Intergenic
1055991169 9:82107254-82107276 TATTATTTTTTTTTAAGGTAAGG + Intergenic
1056263161 9:84869187-84869209 GGAGATTTTTTGCAAAGGTTTGG + Intronic
1058060137 9:100486540-100486562 GAATATTTTTTTAAAAGTTCAGG - Intronic
1058285050 9:103167489-103167511 TAATATTTTTCTCTAGGTTTAGG + Intergenic
1059858629 9:118431404-118431426 GAATGTTTTCCTCTAAGATTGGG - Intergenic
1061045569 9:128163220-128163242 GCATCCTTTTTTCTAGGGTTAGG - Intronic
1061494783 9:130966363-130966385 GAATCTTTTTTTCTGAGTGTTGG - Intergenic
1061968877 9:134032817-134032839 GAGACTTTTTTTGTAAGGTTCGG - Exonic
1186572668 X:10732118-10732140 GAATACTTTCTTCCAAGGTCAGG + Intronic
1186581235 X:10821261-10821283 GAATAATCTTTTTTAAGGTAGGG + Intronic
1186732614 X:12426396-12426418 GAATACTCATCTCTAAGGTTAGG - Intronic
1187011261 X:15282447-15282469 CAATATTTTTTTCTGTGGATAGG - Intronic
1187752330 X:22480159-22480181 GAATATTTTATTCTAAGTTCAGG + Intergenic
1188298682 X:28481896-28481918 GTAGATTTTTTTTTAAAGTTTGG + Intergenic
1188418486 X:29967943-29967965 GAATATTTTTGTATAATATTGGG + Intergenic
1188460731 X:30424185-30424207 GAGTATCTTTCTCAAAGGTTTGG - Intergenic
1188728200 X:33610992-33611014 TAATATTTTTTTCTTAGATAAGG + Intergenic
1189070895 X:37862737-37862759 GAATGTTTTTGGCTAAGGTTTGG + Intronic
1189566657 X:42248495-42248517 CTATATTTTGTTGTAAGGTTAGG + Intergenic
1190017404 X:46839254-46839276 AAATATTTTTTTCTAGGGCCAGG + Intronic
1191160292 X:57322759-57322781 CAATATTCTTTTCTCAGCTTGGG + Intronic
1191800096 X:65069156-65069178 CAATATCTTTTTTTTAGGTTTGG + Intergenic
1191964599 X:66743314-66743336 AAATATATTTTTCAGAGGTTGGG + Intergenic
1192135225 X:68590733-68590755 TAATATCTCTTTCTAAGTTTGGG - Intergenic
1192522010 X:71810551-71810573 TAATATTCTTTTCCAAGTTTGGG + Intergenic
1193064398 X:77243933-77243955 CAAGATTTTCTTCTAAGGTCAGG + Intergenic
1193532201 X:82669377-82669399 CAATAGTTTTGTCAAAGGTTAGG + Intergenic
1193631651 X:83896646-83896668 CAATATTTTTCTCTAGGTTTTGG + Intergenic
1193798549 X:85907192-85907214 GAATATATTTTTCTGATGTCAGG - Intronic
1193805837 X:85993315-85993337 GATTTTTTTTTTCTCAGGATAGG - Intronic
1193887464 X:87000508-87000530 GAATTTTTTTTTCTATTTTTTGG - Intergenic
1194782718 X:98044878-98044900 AAATATTTTTTTCTAATTCTGGG + Intergenic
1195096856 X:101510563-101510585 GAATACTATTCTCTGAGGTTGGG + Intronic
1195807515 X:108792478-108792500 TAATATTTTTCTCTAGGTTTGGG + Intergenic
1195867037 X:109443931-109443953 GAATACTTTTTTCTTAGTATTGG + Intronic
1196019096 X:110971015-110971037 GAATGTTTTTCTCTAAGATTGGG - Intronic
1196254761 X:113503954-113503976 GAATACTATTTTCTAAGGAGTGG + Intergenic
1196523565 X:116704174-116704196 AAATCCTTTTTTCTAAGGTCTGG - Intergenic
1196557287 X:117103196-117103218 AAATATTTTTCTCTAAGATCAGG + Intergenic
1197023713 X:121721154-121721176 GTATAATTTTTCCTATGGTTTGG + Intergenic
1197403137 X:126018066-126018088 TAATATCTTTTTCTAAGTTTGGG + Intergenic
1197424644 X:126280735-126280757 GAATTTTTTTTTCTAATGCTAGG + Intergenic
1197641745 X:128975506-128975528 GAATCTGTTTTTATAAGGCTGGG + Intergenic
1197817750 X:130515697-130515719 GAAAAGTTTTATGTAAGGTTTGG - Intergenic
1198003208 X:132462148-132462170 GAATATTTTGTTCTACATTTTGG + Intronic
1198375796 X:136038617-136038639 TATTATTTTTTTTTAATGTTAGG + Intronic
1199067537 X:143437723-143437745 GAATATAGTTTTCCCAGGTTTGG - Intergenic
1199249737 X:145646807-145646829 GGGTATTTTTTTCTAAGGTCTGG - Intergenic
1199292140 X:146116583-146116605 GAAGCTTTTTCCCTAAGGTTAGG - Intergenic
1199358476 X:146888217-146888239 TGATATCTTTTTCTAAGTTTGGG - Intergenic
1201651473 Y:16293244-16293266 AAATATTTATTTGAAAGGTTAGG + Intergenic
1201687315 Y:16720870-16720892 GTATTTTTTTTTTTTAGGTTTGG - Intergenic