ID: 1069869284

View in Genome Browser
Species Human (GRCh38)
Location 10:71523416-71523438
Sequence GGGCGGAATATTTTTTTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069869284_1069869294 27 Left 1069869284 10:71523416-71523438 CCTTAGAAAAAAATATTCCGCCC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1069869294 10:71523466-71523488 GGAAATGCAATAGCAGCTATTGG No data
1069869284_1069869296 29 Left 1069869284 10:71523416-71523438 CCTTAGAAAAAAATATTCCGCCC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1069869296 10:71523468-71523490 AAATGCAATAGCAGCTATTGGGG No data
1069869284_1069869291 6 Left 1069869284 10:71523416-71523438 CCTTAGAAAAAAATATTCCGCCC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1069869291 10:71523445-71523467 GCCCAAAAGATGGAGATGGAGGG No data
1069869284_1069869295 28 Left 1069869284 10:71523416-71523438 CCTTAGAAAAAAATATTCCGCCC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1069869295 10:71523467-71523489 GAAATGCAATAGCAGCTATTGGG No data
1069869284_1069869286 -4 Left 1069869284 10:71523416-71523438 CCTTAGAAAAAAATATTCCGCCC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1069869286 10:71523435-71523457 GCCCAACACAGCCCAAAAGATGG No data
1069869284_1069869289 2 Left 1069869284 10:71523416-71523438 CCTTAGAAAAAAATATTCCGCCC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1069869289 10:71523441-71523463 CACAGCCCAAAAGATGGAGATGG No data
1069869284_1069869290 5 Left 1069869284 10:71523416-71523438 CCTTAGAAAAAAATATTCCGCCC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1069869290 10:71523444-71523466 AGCCCAAAAGATGGAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069869284 Original CRISPR GGGCGGAATATTTTTTTCTA AGG (reversed) Intronic
904923860 1:34030510-34030532 GGTGGGTATATCTTTTTCTAGGG - Intronic
906177821 1:43790932-43790954 GGCCGGCATCTCTTTTTCTAAGG + Intronic
907488760 1:54795314-54795336 GGGCCAAATATTTGTTTCCATGG - Intronic
909864570 1:80651495-80651517 GGGAGCCATATTTTTTTCTGTGG - Intergenic
911067405 1:93802835-93802857 GAGTGGAATAGTTTTTTCCAGGG - Intronic
916199874 1:162260381-162260403 GGGAGAAATATTTGTCTCTAGGG + Intronic
916247214 1:162700462-162700484 TGGGGGAATATTTTATTCTCAGG + Intronic
923428966 1:233902055-233902077 GAACGGAATATTCTTTTGTATGG + Intergenic
924215640 1:241818781-241818803 GGGAGGAATATTTTGTTCTGAGG - Intergenic
1067276476 10:44839395-44839417 GGGCAGCTTATTTTTTTCTGAGG - Intergenic
1069869284 10:71523416-71523438 GGGCGGAATATTTTTTTCTAAGG - Intronic
1071735532 10:88294859-88294881 TGGTGGAATTTTTTTCTCTATGG + Intronic
1072343093 10:94474934-94474956 GGGGAGAATATATTTTTCTTGGG + Intronic
1074044422 10:109824232-109824254 GCCTGGAATATTTTTCTCTATGG + Intergenic
1075041065 10:119107044-119107066 GGGCGGAATAATTCTTTAAATGG - Intronic
1080046577 11:27814823-27814845 GGGCAGCAGATTTCTTTCTATGG + Intergenic
1084324727 11:68393481-68393503 TGGCTGAATATTTTTTTAAATGG - Intronic
1093231893 12:16555215-16555237 GGGAGAAATATTTCTTGCTAGGG - Intronic
1100624058 12:96311679-96311701 GGGAGGAATTTCTTTTTATAGGG - Intronic
1102764084 12:115416456-115416478 GGGAGGAGGATTTTTTTCTTGGG - Intergenic
1103049150 12:117764236-117764258 GGGCGGATTTTTTTTTTTTAAGG + Intronic
1105817937 13:24053584-24053606 GGTGGGAGTATTTTTCTCTATGG + Intronic
1107081751 13:36382311-36382333 GGGTGAAATAATTTTTCCTAAGG + Intergenic
1107474798 13:40725214-40725236 GGCCTGAATATTTTTTTCACTGG + Intergenic
1108932190 13:55839056-55839078 GAGCCTAATTTTTTTTTCTAAGG - Intergenic
1110099505 13:71579388-71579410 TGGCTGAATATTCTTTACTACGG + Intronic
1110539570 13:76692944-76692966 GGGTGTAATATTTTTTTAAATGG + Intergenic
1114754094 14:25239320-25239342 GGGCAAATTACTTTTTTCTAAGG + Intergenic
1115438160 14:33400832-33400854 TGGTGGGATAATTTTTTCTATGG - Intronic
1116530099 14:45960739-45960761 AGGCAGAATTTATTTTTCTAGGG - Intergenic
1118013270 14:61631870-61631892 AGGTTAAATATTTTTTTCTATGG - Intronic
1122368888 14:101216481-101216503 GGACTGATTATTTTTTTCCAAGG - Intergenic
1122505704 14:102230549-102230571 GGTCGGCATATTTTTCTCTAAGG - Intronic
1123431697 15:20223379-20223401 GGCTGTCATATTTTTTTCTAAGG + Intergenic
1124406166 15:29393941-29393963 GGGAGTAATATTTTTTTCCAGGG - Intronic
1124644222 15:31424555-31424577 GGGTGTAGAATTTTTTTCTAAGG - Intronic
1128176708 15:65562490-65562512 AGGGGTAATATTTTTTTCTTGGG + Intronic
1128354764 15:66918132-66918154 GGGCGGAGGATCTTTTTCCAGGG + Intergenic
1128726978 15:69995439-69995461 GGGCAGACTATTTTCCTCTAAGG - Intergenic
1134468522 16:14500598-14500620 GGTGGTAATATTTTTTTCTAGGG - Intronic
1136852955 16:33627861-33627883 GGCTGTCATATTTTTTTCTAAGG - Intergenic
1137573311 16:49580603-49580625 TGGAAGAATATTTGTTTCTACGG - Intronic
1137841096 16:51641629-51641651 GGGCTGAGCATTCTTTTCTAAGG - Intergenic
1140994685 16:80246753-80246775 AGGCTGCATATTTTTGTCTATGG + Intergenic
1203114551 16_KI270728v1_random:1476281-1476303 GGCTGTCATATTTTTTTCTAAGG - Intergenic
1145950163 17:28811058-28811080 GGGATGAATATTTTTTTTTTTGG - Intronic
1151334021 17:73429697-73429719 GCAGGGAATATTTATTTCTAAGG + Intronic
1156127548 18:33925447-33925469 GTGAGGAAAATTTCTTTCTAGGG - Intronic
1160082286 18:75739776-75739798 CCGAGGAATATTTTCTTCTACGG - Intergenic
1162364424 19:10239465-10239487 GGGGGGAATTTTTTTTTTTTTGG + Intergenic
1165576614 19:36824921-36824943 TGGCTGAATATTATTTTCTGTGG + Intronic
926492438 2:13541205-13541227 GGGCTGCTTATTTTTTTCCATGG + Intergenic
927093286 2:19728598-19728620 GGCCTGAATATTTTTGTTTAAGG - Intergenic
930049272 2:47201725-47201747 GGGCCAAATATTTTTTTCCACGG - Intergenic
937100900 2:119267545-119267567 GGGCTGGTTATTTTTTTCCATGG + Intergenic
939295477 2:140258305-140258327 GGGTGGATTTTTTTTTTTTAAGG - Intronic
940388805 2:153106747-153106769 GGAAGAAATATTTTTTTCCACGG + Intergenic
941269838 2:163411410-163411432 TGGCTGAATATTGTTTGCTAAGG + Intergenic
945839302 2:214868890-214868912 GAGCGGAATAATTTTTTGTTGGG - Intergenic
946876519 2:224135148-224135170 CGGTGGAAGATTTTTTTCAAAGG + Intergenic
1169114239 20:3052697-3052719 TGGCCTAACATTTTTTTCTAAGG - Intergenic
1174075857 20:47936260-47936282 GGGCATAGTATTGTTTTCTAGGG - Intergenic
951131721 3:19054524-19054546 GGGCAGATTTTTTTTTTCTCTGG - Intergenic
953078356 3:39592388-39592410 GTCCAGAATATTTTTTTTTAGGG + Intergenic
953444796 3:42954058-42954080 GGGCAGAGGATTTTTTTTTAGGG - Intronic
955336265 3:58088752-58088774 GGGCTGCATAGTTTTTTCTATGG - Intronic
957785116 3:84872518-84872540 TGGCTGCATATTTTTTTCAAAGG - Intergenic
965246304 3:166275025-166275047 GTGGGAAATACTTTTTTCTAAGG - Intergenic
965428378 3:168555864-168555886 GGCCGGGATAATTTTTTCTGGGG - Intergenic
966267451 3:178063324-178063346 GGGCAGAATATTTTTTATTACGG + Intergenic
967255837 3:187591180-187591202 GGGCAGAATGTGTTTTTCTATGG - Intergenic
968121159 3:196127036-196127058 GGGAGGAATTTTGTTTTTTAAGG - Intergenic
969642794 4:8409315-8409337 GGGCTGGATGTTTCTTTCTAAGG + Intronic
972312254 4:37891787-37891809 GCGCGCAACATTTCTTTCTATGG + Intronic
975322433 4:73023849-73023871 CGGCCGAAGATTTTTTTTTAAGG + Intergenic
976332836 4:83851803-83851825 GAGTGGAGTATTTTCTTCTAGGG + Intergenic
977943567 4:102883826-102883848 TGGCAAAATATTTTTTTCAAAGG + Intronic
984104657 4:175529966-175529988 GGCTGGAATCTTTTATTCTAGGG + Intergenic
984751682 4:183283505-183283527 GGGCATAATATTATTTTCTCAGG - Intronic
987447138 5:18034115-18034137 GGCCGGAATCTTTTTTTAAAAGG - Intergenic
988709465 5:33758923-33758945 GGGAGGAAAATTCTTCTCTAGGG + Intronic
990800602 5:59598594-59598616 GGGTTGAATATTTTTTGCTCTGG + Intronic
994213571 5:97112149-97112171 GGGCTGCATATTTTTCTCTAGGG + Intronic
994679154 5:102863991-102864013 AAGTGGAATATTTTTTTCAAAGG + Intronic
995041764 5:107595996-107596018 GAAGGGAATATTTTTTTCTGAGG - Intronic
995503345 5:112832789-112832811 GGGTGTAATAGTTTTTTCTTTGG + Intronic
995757922 5:115530557-115530579 GGGGGCAAAATTGTTTTCTATGG - Intronic
996678138 5:126200279-126200301 TGGCAGAATATTATTTTCCATGG - Intergenic
999006720 5:147988313-147988335 GGGAGTGATATTTTTTTGTAAGG - Intergenic
999313631 5:150569773-150569795 TGCCAGAATATTTGTTTCTAGGG + Intergenic
1001389998 5:171371095-171371117 GTGCTGAATATTTTTTTTTGGGG - Intergenic
1003423815 6:5983147-5983169 GGACAGAATATATATTTCTAGGG - Intergenic
1007068156 6:39014277-39014299 GGGAGGAACATTTTTTATTATGG + Intronic
1008044485 6:46837704-46837726 TGGCAGAATAAGTTTTTCTAAGG + Intronic
1009619213 6:66050931-66050953 ATGCAGAATATTTCTTTCTATGG + Intergenic
1010025237 6:71207702-71207724 TGCAGGAATTTTTTTTTCTAAGG + Intergenic
1012336754 6:98069264-98069286 GAAAAGAATATTTTTTTCTATGG + Intergenic
1014410136 6:121105584-121105606 AGGCTTAATGTTTTTTTCTAGGG - Intronic
1016823907 6:148370850-148370872 GGTCAGAATATATTTTTGTAGGG - Intronic
1021423680 7:20474166-20474188 GTGGGGAATATTTATTACTAGGG - Intergenic
1023599625 7:41868725-41868747 GGGCTGGATATTTCTTTCTGTGG + Intergenic
1023705659 7:42939154-42939176 AGGCTGAACATTTTTTTCTTTGG + Intronic
1024575404 7:50759638-50759660 GGACTGAATATTTTTATCCATGG + Intronic
1027329755 7:77079439-77079461 GGGCAGATTGCTTTTTTCTATGG - Intergenic
1030863193 7:114663458-114663480 GGTAGGTATATTTTTTACTAAGG - Exonic
1031019048 7:116607331-116607353 GGGCAGAATTTCTTTTTCTTTGG - Intergenic
1036008952 8:4698754-4698776 TGGTGGAATTTTTTTTTTTAAGG - Intronic
1036420514 8:8591260-8591282 GGAAAGAACATTTTTTTCTAAGG - Intergenic
1038078939 8:24110499-24110521 GGTCGGAAGACTTTCTTCTATGG + Intergenic
1045843150 8:106602558-106602580 GGAAGGAATATTTTGTTCTGTGG + Intronic
1046914493 8:119665306-119665328 GAGTGGAATATTTTTATCTGAGG - Intronic
1048674366 8:136761399-136761421 GGTCTCAATATTTGTTTCTATGG + Intergenic
1056857604 9:90147440-90147462 GAGTGGAATATTTGTTACTATGG + Intergenic
1058568257 9:106310556-106310578 GGGCTGGATAATTTTTTCTTAGG + Intergenic
1059319424 9:113456770-113456792 GGGCTGCATATTTTATTATAAGG - Intronic
1059908105 9:119011288-119011310 GGGAGGGAGACTTTTTTCTAAGG - Intergenic
1061178240 9:129009912-129009934 GGACGGAATTTTTTGTTCTGAGG - Intronic
1203492260 Un_GL000224v1:118492-118514 GAAGTGAATATTTTTTTCTAAGG - Intergenic
1203504883 Un_KI270741v1:60364-60386 GAAGTGAATATTTTTTTCTAAGG - Intergenic
1188260622 X:28018577-28018599 TGGCAGAATATCCTTTTCTAGGG + Intergenic
1190152882 X:47962890-47962912 GGGCAGTATATTTGTGTCTAGGG + Intronic
1193064397 X:77243928-77243950 GGGTGCAAGATTTTCTTCTAAGG + Intergenic
1193114684 X:77765474-77765496 AAGTGGAATATTTTTCTCTAAGG - Intronic
1195430146 X:104779951-104779973 GGGCCAAATATTTTCTTCCAGGG - Intronic
1198851111 X:140966280-140966302 TGCAGGAATATTTTTTTTTAAGG - Intergenic