ID: 1069869290

View in Genome Browser
Species Human (GRCh38)
Location 10:71523444-71523466
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069869284_1069869290 5 Left 1069869284 10:71523416-71523438 CCTTAGAAAAAAATATTCCGCCC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1069869290 10:71523444-71523466 AGCCCAAAAGATGGAGATGGAGG No data
1069869281_1069869290 29 Left 1069869281 10:71523392-71523414 CCCTCAAACTCGGGGACTACCAA 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1069869290 10:71523444-71523466 AGCCCAAAAGATGGAGATGGAGG No data
1069869282_1069869290 28 Left 1069869282 10:71523393-71523415 CCTCAAACTCGGGGACTACCAAA 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1069869290 10:71523444-71523466 AGCCCAAAAGATGGAGATGGAGG No data
1069869283_1069869290 10 Left 1069869283 10:71523411-71523433 CCAAACCTTAGAAAAAAATATTC 0: 1
1: 0
2: 3
3: 59
4: 623
Right 1069869290 10:71523444-71523466 AGCCCAAAAGATGGAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr