ID: 1069869913

View in Genome Browser
Species Human (GRCh38)
Location 10:71526840-71526862
Sequence CCCATCTCTGCTCTGTGACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069869913 Original CRISPR CCCATCTCTGCTCTGTGACG TGG (reversed) Intronic
900519837 1:3100203-3100225 CCCCTGCCCGCTCTGTGACGTGG + Intronic
900952162 1:5864251-5864273 CCCACCTCGGCCCTGTGACTCGG - Intronic
902612031 1:17603117-17603139 CCTAGCACTGCTCAGTGACGAGG + Intronic
903136614 1:21313498-21313520 CCCAGCTCTGCTCTGGGCCTGGG - Intronic
904446457 1:30576833-30576855 CCCATCTCAGCTCTGTGGGTCGG + Intergenic
904773770 1:32894738-32894760 AGCAACTCTGCTCTGTGACCAGG - Exonic
915977009 1:160398041-160398063 CCCCTCTCTGTTCTGTGCCTAGG - Intergenic
918141801 1:181726043-181726065 GCCATCTCTGCTTTGTGTCTAGG + Exonic
919382517 1:196876264-196876286 CCCAAATCTGTTCTGTGAAGGGG - Intronic
919837103 1:201582578-201582600 CCCAGCTCTTCTCTGTGTGGGGG - Intergenic
920071050 1:203303672-203303694 CCCATCTCTGCCCTGTAACGTGG - Intergenic
922698409 1:227743460-227743482 CCCGCCTCTCCTCTGTGACTGGG + Intronic
922762351 1:228140807-228140829 CCCGTCTCTGCGCCGTGCCGCGG - Intronic
1064119996 10:12610251-12610273 CCCATCTCTGCCTTGTCACCTGG - Intronic
1067223823 10:44362824-44362846 CATATCTCAGCTCTGAGACGTGG + Intergenic
1067751165 10:48972204-48972226 CCCATGGCTGCTCAGTGAAGGGG + Intronic
1069869913 10:71526840-71526862 CCCATCTCTGCTCTGTGACGTGG - Intronic
1071915612 10:90291721-90291743 CAGATCTCTTTTCTGTGACGTGG + Intergenic
1071941871 10:90599597-90599619 CCTAACTCTGCTTTGTGACAAGG - Intergenic
1075897640 10:126011233-126011255 CCCATCTCTGCTCTCTGAATTGG + Intergenic
1076745430 10:132510414-132510436 CCCAGGTCTGCTCTGCGACCGGG - Intergenic
1076826436 10:132971969-132971991 CCCATCTGTGCACTGTGCCTCGG - Intergenic
1076929854 10:133524656-133524678 CCCCTGTCTTCTCTGTGACTGGG - Intronic
1077640779 11:3879575-3879597 CCCACAGCTGCTCTGTGAGGTGG + Intronic
1077711148 11:4538411-4538433 CACATCTCTGATCTGAGAAGTGG + Intergenic
1077783966 11:5362518-5362540 TTCATCTCTGCTCTCTGACTAGG - Intronic
1080663466 11:34315634-34315656 CCCATGTCTGCTCAGCGCCGAGG - Intronic
1081628216 11:44668270-44668292 CTCAGCTCTGCTCTGTGCAGAGG + Intergenic
1084070595 11:66731254-66731276 CCTATCTCAGCTCTGTGACTGGG + Intergenic
1084335515 11:68455448-68455470 CCCATCTCTGCTCTGGTTGGTGG - Intergenic
1085457589 11:76674038-76674060 CACATCTCTGCACTGAGACCTGG - Intergenic
1086307123 11:85493663-85493685 CCCTTCTCTCCTCTCTGACATGG - Intronic
1088704083 11:112445800-112445822 TCCTTCTCTGCTCTGTGGCCTGG + Intergenic
1089337785 11:117736922-117736944 CCAGTTTCTGCTCTGTGAAGTGG + Intronic
1089665720 11:120017317-120017339 CACCTCTGTGCTCTGTGAGGCGG - Intergenic
1089787426 11:120918057-120918079 CTCATCTCTGCTGTGTGGCTGGG - Intronic
1090644149 11:128753975-128753997 CCCAACTCTGCTCTTTCACTTGG + Intronic
1090921418 11:131209392-131209414 CCCATCTCTGCTCTGCACCTTGG + Intergenic
1091392002 12:131375-131397 CCTCTCTCTGCTCTCTGACCTGG + Intronic
1091775344 12:3181373-3181395 CCCAGCTCTGCCCCGTGACAAGG - Intronic
1094473684 12:30825321-30825343 CCCCTGTCTGCTGTGTGATGGGG + Intergenic
1094581653 12:31739179-31739201 CTCCTCTCTGCTCTGTGCTGGGG + Intergenic
1095824883 12:46520633-46520655 CACATCACTGCCCTGTGAGGGGG + Intergenic
1096477243 12:51915767-51915789 TCCAGGTCTGCTCTGTGAAGTGG + Intronic
1096776750 12:53969075-53969097 CCCGCCTCTGCTCTGTGGTGAGG + Intergenic
1098530440 12:71535705-71535727 CACATCTGTGTTCTGTGATGGGG - Intronic
1101376399 12:104175053-104175075 CCCATATCTGCTCAGTAATGAGG + Intergenic
1102168864 12:110826951-110826973 CCCACCTCTGCGATGTGACTCGG - Intergenic
1103444211 12:120983392-120983414 CCCACATCTGCCCTGTAACGTGG - Intronic
1104721677 12:131047977-131047999 CCCATCTCACCCCTGTGACATGG - Intronic
1105686826 13:22792364-22792386 CCCATTTCTGCTCTCTGCAGCGG - Intergenic
1106460079 13:29960797-29960819 AACCTCTCTGCTCTGTGACCTGG - Intergenic
1109276739 13:60311903-60311925 CCCTTCTCTGCTCTGTGCCATGG - Intergenic
1111144072 13:84157610-84157632 CCCATCCCAGCTCTGTGATGAGG + Intergenic
1112485988 13:99820101-99820123 CCCATCTATGCTGTGTCTCGCGG + Intronic
1112817004 13:103284361-103284383 CCTATCTCTGTTCTGTGGTGAGG - Intergenic
1113730349 13:112637104-112637126 CCCATGTCTGCTCTAGGGCGAGG + Intergenic
1115705173 14:35990875-35990897 CTCATATCTTCTCTGTGAAGTGG + Intergenic
1119944142 14:78674001-78674023 GCCATATCTGCTCTGTCACATGG - Intronic
1123130038 14:105977762-105977784 CCCACCTCTGCTGTGAGATGAGG + Intergenic
1123701593 15:22918242-22918264 CCCAGCTCTGCTCCGTGCGGAGG - Intronic
1126468229 15:48980043-48980065 GCCATCTCTGCTCTGGCCCGGGG + Intergenic
1128106633 15:65050142-65050164 CCAAACTCTGCTCTGTGTTGAGG - Intronic
1128557596 15:68642256-68642278 CCCAACCCTGCTGTGTGACTTGG - Intronic
1128673248 15:69590329-69590351 ACCATTTATGCTCTGTGGCGAGG + Intergenic
1130435841 15:83898596-83898618 CCCATTTCTGCTCTTTCATGTGG - Intronic
1130919359 15:88331307-88331329 CCCAGCTCTGCTCTGTTAAAGGG - Intergenic
1132244091 15:100280981-100281003 CCCAGATCTGCTCAGTGATGGGG - Intronic
1133863174 16:9616232-9616254 CTCCACTCTGCTCTGTGACCTGG + Intergenic
1139690282 16:68637074-68637096 CTCCTCTCAGCTCTGTGAGGTGG + Intronic
1140816228 16:78623341-78623363 CCCATCTCTCCTCTGAAACCTGG - Intronic
1142103076 16:88285812-88285834 GCCACCACTGCACTGTGACGAGG - Intergenic
1142273100 16:89101236-89101258 TCCATCCCTGCTCTGGGACCGGG - Exonic
1143020300 17:3914115-3914137 CCACCCTCTGCTGTGTGACGTGG + Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1144960570 17:19042018-19042040 CCCAGCCCTGCTCTGTGAGTAGG - Intronic
1144974590 17:19132506-19132528 CCCAGCCCTGCTCTGTGAGTAGG + Intronic
1148450556 17:47775067-47775089 CTCATCTATGCTCTTTGAAGAGG + Intergenic
1149595526 17:57862541-57862563 CCCATCCCTGCTGGGTGACCGGG + Exonic
1152529674 17:80910203-80910225 CCCGTCTCTGCACTGTGGCCTGG + Intronic
1152932829 17:83119056-83119078 CCCATCTCTGTTCTTTGAGCTGG - Intergenic
1153396899 18:4632790-4632812 CCCTTCCCTGCACTGTGACCTGG - Intergenic
1153561478 18:6375769-6375791 CCCATGTCTGTTCTGTCACCAGG - Intronic
1158210260 18:55040970-55040992 CACATCTCTCCCCTGTGAAGAGG + Intergenic
1158446652 18:57528032-57528054 CTTATCTCTGCTCTGTGTCCGGG + Intergenic
1158578454 18:58660650-58660672 CCCAGCTCTGCTCTGGGCCTTGG - Intergenic
1159919172 18:74212420-74212442 CCCAGCTCGGCTGTGTCACGGGG - Intergenic
1161488215 19:4547382-4547404 CCCATCTCAGCTCTGCCACTTGG - Intronic
1162502497 19:11061847-11061869 GCCATCTCAGCTCTGGAACGAGG - Exonic
1163035079 19:14565307-14565329 CCCCTCTCTGCCCTGGGACTTGG + Intronic
1163215125 19:15871025-15871047 CTCAGCTCTGCTGTGTGACTTGG - Intergenic
1163228294 19:15980174-15980196 CTCAGCTCTGCTGTGTGACTTGG - Intergenic
1165927192 19:39334301-39334323 CCCATCTCGGCTGGGTGCCGTGG - Intronic
1166567177 19:43772328-43772350 CTCCTCTCTGCTGTGTGACCTGG + Intronic
1166858290 19:45794285-45794307 TCCATCTCGGCTCAGAGACGGGG + Intergenic
1167684373 19:50946914-50946936 CCCATTTCTTCTCTGTGCCCTGG - Intronic
1168103559 19:54153598-54153620 CCCAACTGTGGTCTGTGGCGGGG + Intronic
925634678 2:5931824-5931846 CCCTTCTTAGCTCTGTGACCCGG - Intergenic
926437541 2:12853494-12853516 CCCATCAGTGCTCTGTGTCTAGG - Intergenic
926812406 2:16767180-16767202 CCCATCTATGCTCACTGATGTGG - Intergenic
928375338 2:30769074-30769096 CCCATCTGTGCACTGTGACTGGG - Intronic
928433998 2:31241993-31242015 CCCATCTGTGCCCTGTGTGGCGG + Intronic
932441932 2:71743079-71743101 CCCTTCTCTGCTTTGTCATGAGG - Intergenic
933897166 2:86822060-86822082 TTCATCTCTGCCCTGTGACTGGG - Intronic
937913593 2:127088080-127088102 CCCACCCCGGCTCTGGGACGTGG + Intronic
940071202 2:149690026-149690048 TCCATCTCTGCTCAGTGCCAAGG - Intergenic
942844446 2:180405764-180405786 CGCATATCTGCTCTATGACCTGG - Intergenic
948230511 2:236345643-236345665 CCCATCCCAGCTCTGTCGCGAGG - Intronic
948375085 2:237515956-237515978 TCACTCTCTGCTCTGTGATGTGG - Intronic
948882975 2:240869699-240869721 ACCAGCTCTGCTTTGTGACAGGG + Intronic
949028593 2:241777712-241777734 CACCTCTCAGCCCTGTGACGGGG - Intronic
1168810062 20:699428-699450 CCCATCTCGTCTCTGGGACTTGG - Intergenic
1171005615 20:21462703-21462725 CCCTGCTCTGCTCTGTGCCCTGG - Intergenic
1171482666 20:25465643-25465665 GCCGTCCCTGCTCTGTGATGTGG - Intronic
1172682744 20:36729456-36729478 TCCATCTCTCCTCAGTGATGAGG - Intronic
1174450413 20:50616702-50616724 CTCTTCTCTGCTGTGTGACCGGG - Intronic
1176178887 20:63740514-63740536 CTCACCTCTGCGCTGGGACGGGG - Exonic
1177995739 21:28095037-28095059 CTCATCTCTGCTCTTAGACCTGG - Intergenic
1178721087 21:35009642-35009664 CCCATTTATGCACTGTGACCTGG + Intronic
1179980495 21:44893256-44893278 CCCATCCCAGCACTCTGACGGGG - Intronic
1180058565 21:45373339-45373361 CCCACCTTTGCTGTGTGACTTGG - Intergenic
1181009451 22:20032017-20032039 CCCATCCCTGCCATGTGACCTGG + Intronic
1182955264 22:34418451-34418473 CCCATCTCTGCTCTTTCATTGGG - Intergenic
1183668320 22:39257606-39257628 CCATCCTCTGCTCTGTGGCGAGG - Intergenic
1184124173 22:42475323-42475345 CCCATCTCTTCTCTGCCCCGGGG + Intergenic
1185382424 22:50516111-50516133 CCCTTTTCTTCTCTGTGTCGGGG + Intronic
951372709 3:21870745-21870767 CCCATTTCTGCTCTGTGAACTGG + Intronic
953237336 3:41118150-41118172 TCAAACTCTGATCTGTGACGTGG - Intergenic
953409654 3:42683476-42683498 CCCATGTCCGCTGTGTGACTTGG + Intergenic
953702537 3:45207915-45207937 GCCATTTCTGCTCTGTGACTTGG - Intergenic
956346372 3:68283747-68283769 CCCATCCCTGCTTTGTGCTGTGG - Intronic
958868137 3:99525219-99525241 CCCATCTTTGCTATGAGAAGTGG - Intergenic
961695533 3:128701581-128701603 CCCATCTCTCCTCTCTGCCCTGG + Intergenic
962217604 3:133536107-133536129 CCCTTCTCTGCTCTCTGAATGGG + Intergenic
962328858 3:134459826-134459848 CCCATTTCTGCTCTGATATGAGG + Intergenic
962514528 3:136137963-136137985 CCCAACTCTCCTCAGTGAGGTGG + Intronic
963986605 3:151602741-151602763 CCCATCTTTGCTCTTTTAAGTGG + Intergenic
965425491 3:168517656-168517678 CTCATCTCTCCCCTGTGAAGAGG - Intergenic
967339921 3:188385381-188385403 CCCCTCTCAGCTCTGTCACGAGG - Intronic
968454158 4:688789-688811 CCCAGCCCTGCTCTGTGCCCTGG + Intronic
968579306 4:1382559-1382581 TCCATCTCTGCTGGGTGCCGGGG + Intronic
968772048 4:2513611-2513633 CCCATGGCTGCTCTGGGACAAGG + Intronic
968930489 4:3576223-3576245 CCCAGCTCTGCTCTGCCACCAGG - Intergenic
969671941 4:8594472-8594494 CTCAACTCTGCTGTGTGACCTGG + Intronic
970310856 4:14780897-14780919 CCTGGCTCTGCTCTGTGACTTGG + Intergenic
971191970 4:24436778-24436800 CCGATGTCAGCTCTGTGACCCGG - Intergenic
974188036 4:58465351-58465373 CCCACCCCTGCCCTGTGAGGAGG - Intergenic
981843416 4:149138207-149138229 CCCATCCCTGCCCTGTGGCCAGG - Intergenic
984949117 4:184993685-184993707 CCCAGCCCAGCTCTGTGGCGGGG - Intergenic
985419002 4:189764793-189764815 CCCATCTCTGCTCAGAGTCCTGG + Intergenic
987912294 5:24163421-24163443 CCCATCTCAGGTTTGTGACAGGG + Intronic
988802640 5:34710990-34711012 CCCATCACTTCTCTTTGACCAGG - Intronic
988805185 5:34733819-34733841 CACATCTCAGCTCCGTGACTCGG + Intronic
988945491 5:36192994-36193016 AACATTTCTGCTCTGTGATGGGG - Intronic
988968249 5:36441226-36441248 CACATCTCTGCTCTCTGCAGTGG - Intergenic
991141532 5:63249718-63249740 CCCATCTCTGTTCTTTGTCTTGG - Intergenic
993719324 5:91306630-91306652 CCTATGTCTGCTCTGAGACTTGG - Intergenic
993992346 5:94674773-94674795 CCCACCTCTGCTCTTTGCCAAGG - Intronic
995207365 5:109496596-109496618 TCCATCTCTGTTGTGTGACACGG - Intergenic
1002706069 5:181161362-181161384 CCCATGTCTGCTGTGTGAGCAGG - Intergenic
1003498001 6:6681287-6681309 CCCATCGCAGCTGTGTGACATGG - Intergenic
1004045668 6:12020467-12020489 CTCATCGCTGCTCTGTGGAGGGG + Intronic
1004248271 6:14001363-14001385 TCAGTCTCTGCTCTGTAACGTGG - Intergenic
1006832526 6:36977469-36977491 CCAATCTCTCCTCAGTGAGGTGG + Intronic
1007116261 6:39345380-39345402 CCCTGCTCTGCTCTGTGGTGGGG + Intronic
1007725977 6:43915826-43915848 CCCAAGTCTCCTCTGTGAGGCGG - Intergenic
1010543698 6:77124178-77124200 GCCCTCTCTGCTCTATGACCAGG + Intergenic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1016383252 6:143507015-143507037 ACCATCTTTCCTCTGTTACGTGG + Intronic
1017268441 6:152478494-152478516 ACCATCTGTGCTCTGGGCCGAGG - Intronic
1018262143 6:161980751-161980773 CCCCTCTCTGCTCTGTAAGTTGG - Intronic
1019171312 6:170134757-170134779 CCCAGGGCTGCTGTGTGACGTGG + Intergenic
1019614662 7:1953813-1953835 CCCATCACTGCTGGGTGACACGG + Intronic
1020759207 7:12247435-12247457 CCCATCTCTCCCCTGTTACATGG - Intergenic
1023347701 7:39288298-39288320 CCCCTCTCAGCTATGTGACATGG + Intronic
1024393635 7:48842614-48842636 GTCATCTCTACTCAGTGACGAGG + Intergenic
1024967492 7:55037010-55037032 CCCATGTTTGCTCTGTGAATTGG - Intronic
1029043413 7:97601214-97601236 CCCATATCTTCTCTGTGAACTGG + Intergenic
1030106322 7:105990414-105990436 CCCACCTCTGAGCTGAGACGAGG + Intronic
1030694731 7:112572376-112572398 CTCTTCTCTGCTCTGTGCCTAGG - Intergenic
1033004564 7:137547704-137547726 CCCTTCTCTGCTCTGTGGGGAGG - Intronic
1034588466 7:152117748-152117770 ACCACCTCTGCTCTGTGATTTGG - Intronic
1034893224 7:154858630-154858652 AGCATCTCTTCCCTGTGACGTGG - Intronic
1036279759 8:7390772-7390794 CCGATCTCTGCTAAGTGACTGGG + Intergenic
1036341760 8:7921111-7921133 CCGATCTCTGCTAAGTGACTGGG - Intergenic
1037406694 8:18549927-18549949 CCCATCTCATTTCTATGACGAGG + Intronic
1041317725 8:56581882-56581904 CCCAGCTCCTCTCTGTGAGGGGG - Intergenic
1047414053 8:124649388-124649410 TCCATCGCTGCTCTGTGCTGGGG - Intronic
1048854233 8:138673072-138673094 CCAATCTCTGCACTGTCACCAGG - Intronic
1049365410 8:142234607-142234629 CCCAGCCCTGCTGTGTGACCAGG + Intronic
1053218989 9:36295596-36295618 CCCATCTCTCTTCTGTTATGGGG + Intronic
1054459620 9:65455691-65455713 CCCAGCTCTGCTCTGCCACCAGG + Intergenic
1056491566 9:87112919-87112941 CCCATGACTGCTCTGTGGTGGGG - Intergenic
1057304414 9:93904009-93904031 CCCGTGTCTGCTCTGTGACGAGG + Intergenic
1057875838 9:98753985-98754007 CCCATCTCTTCCCAGTGTCGTGG + Intronic
1059499114 9:114735862-114735884 CCCAGCTCTGTTTTGTGACTTGG - Intergenic
1062248904 9:135584348-135584370 CCCTTCTCTGCTCTGTAGAGGGG + Intergenic
1062358662 9:136177188-136177210 CCCATCTCTGCCATCTGAGGAGG + Intergenic
1186325653 X:8473975-8473997 CACATCTTTGCTCTTTGATGTGG - Intergenic
1189124608 X:38433170-38433192 CCCTTCTCTGGTCTCTGAAGAGG + Intronic
1195113157 X:101667393-101667415 CCCTCCTCTGCTCTGGGACAGGG - Intergenic
1196741812 X:119031821-119031843 CCCTTCTCTACTCTCTTACGTGG - Intergenic
1200946991 Y:8852383-8852405 CCAATCTGTGCTCTGTAACATGG - Intergenic
1201436239 Y:13961693-13961715 CACATCTTTGCTCTTTGATGTGG + Intergenic