ID: 1069871392

View in Genome Browser
Species Human (GRCh38)
Location 10:71535328-71535350
Sequence TGATTCCCTCACACAGGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069871382_1069871392 19 Left 1069871382 10:71535286-71535308 CCTGATCAGGTCTCCATGTTCTA 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1069871392 10:71535328-71535350 TGATTCCCTCACACAGGGCGTGG No data
1069871388_1069871392 6 Left 1069871388 10:71535299-71535321 CCATGTTCTACCGGGAGGAGGGT 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1069871392 10:71535328-71535350 TGATTCCCTCACACAGGGCGTGG No data
1069871389_1069871392 -4 Left 1069871389 10:71535309-71535331 CCGGGAGGAGGGTGAGCTCTGAT 0: 1
1: 0
2: 2
3: 17
4: 267
Right 1069871392 10:71535328-71535350 TGATTCCCTCACACAGGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069871392 Original CRISPR TGATTCCCTCACACAGGGCG TGG Intronic
No off target data available for this crispr