ID: 1069871909

View in Genome Browser
Species Human (GRCh38)
Location 10:71538289-71538311
Sequence CTGACATATTTTCCCTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069871909_1069871914 0 Left 1069871909 10:71538289-71538311 CCCAGTGAGGGAAAATATGTCAG No data
Right 1069871914 10:71538312-71538334 CCTGGTGCCTGGCAGTTTCTTGG No data
1069871909_1069871916 12 Left 1069871909 10:71538289-71538311 CCCAGTGAGGGAAAATATGTCAG No data
Right 1069871916 10:71538324-71538346 CAGTTTCTTGGCTTATTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069871909 Original CRISPR CTGACATATTTTCCCTCACT GGG (reversed) Intronic