ID: 1069871909 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:71538289-71538311 |
| Sequence | CTGACATATTTTCCCTCACT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1069871909_1069871914 | 0 | Left | 1069871909 | 10:71538289-71538311 | CCCAGTGAGGGAAAATATGTCAG | No data | ||
| Right | 1069871914 | 10:71538312-71538334 | CCTGGTGCCTGGCAGTTTCTTGG | No data | ||||
| 1069871909_1069871916 | 12 | Left | 1069871909 | 10:71538289-71538311 | CCCAGTGAGGGAAAATATGTCAG | No data | ||
| Right | 1069871916 | 10:71538324-71538346 | CAGTTTCTTGGCTTATTGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1069871909 | Original CRISPR | CTGACATATTTTCCCTCACT GGG (reversed) | Intronic | ||