ID: 1069877030

View in Genome Browser
Species Human (GRCh38)
Location 10:71569213-71569235
Sequence GCACCCACTCCCATCCCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069877021_1069877030 28 Left 1069877021 10:71569162-71569184 CCGAGAACCTCTCTGCTCACCTC No data
Right 1069877030 10:71569213-71569235 GCACCCACTCCCATCCCTAAAGG No data
1069877022_1069877030 21 Left 1069877022 10:71569169-71569191 CCTCTCTGCTCACCTCCTGCTTC No data
Right 1069877030 10:71569213-71569235 GCACCCACTCCCATCCCTAAAGG No data
1069877023_1069877030 9 Left 1069877023 10:71569181-71569203 CCTCCTGCTTCCAGACCTTCCTC No data
Right 1069877030 10:71569213-71569235 GCACCCACTCCCATCCCTAAAGG No data
1069877024_1069877030 6 Left 1069877024 10:71569184-71569206 CCTGCTTCCAGACCTTCCTCTCC No data
Right 1069877030 10:71569213-71569235 GCACCCACTCCCATCCCTAAAGG No data
1069877026_1069877030 -6 Left 1069877026 10:71569196-71569218 CCTTCCTCTCCCTTGCAGCACCC No data
Right 1069877030 10:71569213-71569235 GCACCCACTCCCATCCCTAAAGG No data
1069877027_1069877030 -10 Left 1069877027 10:71569200-71569222 CCTCTCCCTTGCAGCACCCACTC No data
Right 1069877030 10:71569213-71569235 GCACCCACTCCCATCCCTAAAGG No data
1069877025_1069877030 -1 Left 1069877025 10:71569191-71569213 CCAGACCTTCCTCTCCCTTGCAG No data
Right 1069877030 10:71569213-71569235 GCACCCACTCCCATCCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069877030 Original CRISPR GCACCCACTCCCATCCCTAA AGG Intronic