ID: 1069878320

View in Genome Browser
Species Human (GRCh38)
Location 10:71576534-71576556
Sequence GCTGATAAACAGTGAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069878309_1069878320 27 Left 1069878309 10:71576484-71576506 CCTCTGCACAGGTGAAGGGGGTG 0: 1
1: 0
2: 2
3: 23
4: 201
Right 1069878320 10:71576534-71576556 GCTGATAAACAGTGAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069878320 Original CRISPR GCTGATAAACAGTGAGTGGA GGG Intronic
No off target data available for this crispr