ID: 1069879219

View in Genome Browser
Species Human (GRCh38)
Location 10:71581270-71581292
Sequence TTAAGGGCTTTGTAGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069879207_1069879219 21 Left 1069879207 10:71581226-71581248 CCAGCCCTAGCTGCTCAGGAACC 0: 1
1: 0
2: 1
3: 15
4: 229
Right 1069879219 10:71581270-71581292 TTAAGGGCTTTGTAGGGGGTGGG No data
1069879206_1069879219 22 Left 1069879206 10:71581225-71581247 CCCAGCCCTAGCTGCTCAGGAAC 0: 1
1: 0
2: 1
3: 17
4: 217
Right 1069879219 10:71581270-71581292 TTAAGGGCTTTGTAGGGGGTGGG No data
1069879209_1069879219 16 Left 1069879209 10:71581231-71581253 CCTAGCTGCTCAGGAACCATTTT 0: 1
1: 0
2: 1
3: 24
4: 196
Right 1069879219 10:71581270-71581292 TTAAGGGCTTTGTAGGGGGTGGG No data
1069879208_1069879219 17 Left 1069879208 10:71581230-71581252 CCCTAGCTGCTCAGGAACCATTT 0: 1
1: 0
2: 2
3: 13
4: 166
Right 1069879219 10:71581270-71581292 TTAAGGGCTTTGTAGGGGGTGGG No data
1069879212_1069879219 -7 Left 1069879212 10:71581254-71581276 CCTTTGAAAGAAAGAATTAAGGG 0: 1
1: 0
2: 2
3: 51
4: 377
Right 1069879219 10:71581270-71581292 TTAAGGGCTTTGTAGGGGGTGGG No data
1069879210_1069879219 0 Left 1069879210 10:71581247-71581269 CCATTTTCCTTTGAAAGAAAGAA 0: 1
1: 0
2: 12
3: 114
4: 979
Right 1069879219 10:71581270-71581292 TTAAGGGCTTTGTAGGGGGTGGG No data
1069879203_1069879219 27 Left 1069879203 10:71581220-71581242 CCTGCCCCAGCCCTAGCTGCTCA 0: 1
1: 1
2: 4
3: 80
4: 603
Right 1069879219 10:71581270-71581292 TTAAGGGCTTTGTAGGGGGTGGG No data
1069879205_1069879219 23 Left 1069879205 10:71581224-71581246 CCCCAGCCCTAGCTGCTCAGGAA 0: 1
1: 0
2: 1
3: 62
4: 623
Right 1069879219 10:71581270-71581292 TTAAGGGCTTTGTAGGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069879219 Original CRISPR TTAAGGGCTTTGTAGGGGGT GGG Intronic
No off target data available for this crispr