ID: 1069880618

View in Genome Browser
Species Human (GRCh38)
Location 10:71590437-71590459
Sequence CTCACGAACTGGCAGTCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069880618_1069880622 1 Left 1069880618 10:71590437-71590459 CCCTTTGACTGCCAGTTCGTGAG 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1069880622 10:71590461-71590483 ATCTCCCCGCCCTCACTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069880618 Original CRISPR CTCACGAACTGGCAGTCAAA GGG (reversed) Intronic
901117943 1:6863898-6863920 CTAACAAACTGTCAGTCTAATGG - Intronic
903906080 1:26687906-26687928 ATCACTCACAGGCAGTCAAAAGG + Intergenic
905690889 1:39941834-39941856 CTCAAGTACTGGCAGGCCAAGGG - Intergenic
905931387 1:41790234-41790256 CTCAAGAGCTGGTTGTCAAAAGG + Intronic
906724888 1:48037014-48037036 CTCAGAGACTGGCAGTCAGAGGG - Intergenic
908101208 1:60793217-60793239 CTCACAAAATGGTTGTCAAAAGG - Intergenic
915126572 1:153669831-153669853 CTCACCAAATAGAAGTCAAATGG + Exonic
915515664 1:156411047-156411069 CTGAGGAACTGGCAGTCTACTGG - Intronic
916644755 1:166772033-166772055 CTCATGTACTGACTGTCAAAAGG - Intergenic
917107977 1:171514104-171514126 CTCCCCACCTGGCAGTCAACAGG - Intronic
918762636 1:188432898-188432920 CTAGTGAACTGGTAGTCAAAAGG - Intergenic
923400503 1:233611866-233611888 CACACAATCTGGCATTCAAAGGG + Intergenic
924075955 1:240337091-240337113 CTGACTAAATGGGAGTCAAACGG + Intronic
1063864915 10:10353483-10353505 CTAACGAACCGGGAGTCACATGG - Intergenic
1069420441 10:68241807-68241829 CTCAAGAACAGGCAGTCCCAGGG - Intergenic
1069880618 10:71590437-71590459 CTCACGAACTGGCAGTCAAAGGG - Intronic
1073252246 10:102128001-102128023 CTCACAAGGTTGCAGTCAAATGG + Intergenic
1073678193 10:105673348-105673370 CTCAGAAACTGGCAGTAAAATGG - Intergenic
1080275487 11:30499005-30499027 CTCATGAACTGAAAGTCAACAGG + Intronic
1088106965 11:106218269-106218291 CTTATGAACTGACATTCAAAAGG - Intergenic
1091744281 12:2981334-2981356 CTCAGGAGCTGGAAGACAAAGGG - Intronic
1092360596 12:7833139-7833161 CTCACGAACTGGGAGGAAAGAGG + Intronic
1092744134 12:11657731-11657753 CTCACCAACTGGCACTCAGCAGG - Intronic
1093532281 12:20181459-20181481 ATCTCAAACTGGCAATCAAATGG - Intergenic
1094359954 12:29620042-29620064 CTCAAGAAAAGGCAGTCAATTGG + Intronic
1097397891 12:59098254-59098276 CTGATGAATTGGCAGTGAAAAGG + Intergenic
1099889616 12:88574707-88574729 CACACGTACTGGAAGTTAAAGGG + Intronic
1106203560 13:27566688-27566710 CTCAAGAAGTGGCAGGAAAATGG + Intronic
1112311476 13:98321003-98321025 CTCACGAACTGGGAGTCTTTGGG + Intronic
1114133778 14:19822975-19822997 CTAAAAAACTGGCATTCAAATGG + Intronic
1114249257 14:20944050-20944072 CTCAGGAACTGTCAGTCCAGTGG + Intergenic
1123576854 15:21678570-21678592 CTAAAAAACTGGCATTCAAATGG + Intergenic
1123613476 15:22121038-22121060 CTAAAAAACTGGCATTCAAATGG + Intergenic
1126593602 15:50364211-50364233 CTCACGAGCAGGGAGACAAATGG - Intergenic
1202985722 15_KI270727v1_random:412815-412837 CTAAAAAACTGGCATTCAAATGG + Intergenic
1139914594 16:70420242-70420264 CCCACGAACTGCCATACAAAAGG - Intronic
1140849033 16:78917244-78917266 CTCACGAACTGAGAGTCAGGAGG + Intronic
1141326807 16:83068043-83068065 TTCACAAAGTGGCAGTCATATGG - Intronic
1143181765 17:4987894-4987916 CTCTCGAACTGGGAGTCAGTCGG - Intergenic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1151797291 17:76354679-76354701 CTCACGATGTGGCCGTAAAATGG - Intronic
1152463587 17:80453951-80453973 CTCACTAAGTGGGAGTCACAGGG + Intergenic
1154499666 18:14989450-14989472 CTCAGTAACTGACTGTCAAAAGG + Intergenic
1157684214 18:49629696-49629718 CTAAGGGATTGGCAGTCAAATGG + Intergenic
1157891836 18:51425534-51425556 CTTACGAATTTGCAGTCAGATGG + Intergenic
1167621476 19:50563317-50563339 CTCAGGAACTGGGACTCGAAGGG + Intronic
926520409 2:13904854-13904876 CTTACAAACTGGCAGTCTCAAGG - Intergenic
929091767 2:38224498-38224520 CTCAATAAATGACAGTCAAATGG + Intergenic
929543350 2:42839274-42839296 CTCATGTAGTCGCAGTCAAATGG - Intergenic
930870693 2:56167815-56167837 CTATCCATCTGGCAGTCAAAAGG + Intergenic
932553229 2:72794268-72794290 GTCTCCAACTGGCAGTCACATGG + Intronic
936111263 2:109667305-109667327 CTCTCTAAATGGCAGTCAATTGG - Intergenic
937801258 2:126082805-126082827 CTCACAAACTATCAGTTAAATGG + Intergenic
938498874 2:131819805-131819827 CTCAGTAACTGACTGTCAAAAGG + Intergenic
939277654 2:140020674-140020696 CTCAGAAACTGGCAGTCAAGAGG - Intergenic
942836734 2:180308070-180308092 CACAAGAACTTGCAGTCAAAAGG + Intergenic
944263793 2:197702412-197702434 CTCCAGAACTGGCAGATAAATGG - Intronic
945039319 2:205730864-205730886 CTCACCCACTGGCAGTAAAAAGG - Intronic
946086462 2:217178402-217178424 CTCACAATGTTGCAGTCAAATGG + Intergenic
947670224 2:231930998-231931020 CTCTCCATCTGGCTGTCAAAGGG + Intergenic
948272901 2:236687732-236687754 ACCAGGAACTGGCAGTCACAGGG + Intergenic
1172202516 20:33136405-33136427 CTCTCAAACTGGCAGTCCCAGGG + Intergenic
1174849554 20:53979376-53979398 CTCTCGAACTGGCTGTCTACTGG + Intronic
960157251 3:114308640-114308662 CTCAAGAACTTACAGTTAAATGG + Exonic
961728227 3:128947060-128947082 CTCTGGAACTGGCAGTAAAAAGG + Intronic
964209945 3:154215412-154215434 CTCACGGAAGGGCAGACAAAAGG - Intronic
971619398 4:28835731-28835753 CTCACAAACTGGCCCTCATATGG - Intergenic
976410986 4:84713355-84713377 CCCACTAAATGGCAGGCAAAAGG + Intronic
978238002 4:106483326-106483348 CTGACGAAGTTGCAGTGAAAAGG - Intergenic
978841389 4:113217606-113217628 CTCATGAACTGCCTGTGAAAGGG - Intronic
979304286 4:119124610-119124632 TTTAAGAACTGGCAGTCAAAGGG + Intergenic
981345088 4:143665373-143665395 CTCAAGAACTTACAGTCTAATGG - Intronic
987491495 5:18585199-18585221 TTCAGGAACTGGCAGTTCAATGG - Intergenic
987942240 5:24554170-24554192 CTTACGAAGTTGCAGTCAAATGG - Intronic
988093158 5:26568755-26568777 CTCACAAAGTGGCAAGCAAAGGG + Intergenic
988688546 5:33549283-33549305 GCCAGGAACTGGCAGTGAAATGG + Exonic
990050124 5:51488016-51488038 TTCATGAACTGGCAATTAAAGGG + Intergenic
992610260 5:78501810-78501832 ATCAGGAACTAGAAGTCAAAGGG + Intronic
995311869 5:110722346-110722368 CTCATGAAGTTGCAGTCAAATGG + Intronic
997816573 5:137025044-137025066 ATCAAAAACTGTCAGTCAAATGG + Intronic
1004054445 6:12121511-12121533 CTTAAGAACTGACAGTCCAAAGG + Exonic
1006101442 6:31688517-31688539 CTCAGGATCTGGCAACCAAAGGG - Intronic
1013480449 6:110548583-110548605 CTCAGGATCTGGCACTGAAAAGG + Intergenic
1015079305 6:129204318-129204340 CTGACAACCTGGCAGTGAAAGGG + Intronic
1021075662 7:16301388-16301410 CACAGGAACTGACAGTCATAAGG + Intronic
1042412855 8:68484122-68484144 AGCAGGAACTAGCAGTCAAATGG + Intronic
1043908852 8:85837041-85837063 CTCACTCACTGCCAGACAAATGG - Intergenic
1045523350 8:102922153-102922175 CTCACGCACTGTCTGTGAAAAGG - Intronic
1048593796 8:135845587-135845609 CACACCTACTGGGAGTCAAAGGG + Intergenic
1050310258 9:4345443-4345465 CTCATGAACTTGCATTCTAATGG - Intronic
1052929858 9:34047497-34047519 TTCACAAACTGGCACTAAAACGG + Intronic
1053647907 9:40134059-40134081 CTCAGTAACTGACTGTCAAAAGG - Intergenic
1056145372 9:83723703-83723725 CTCATTAACAGGCAGTAAAATGG + Intergenic
1060149018 9:121275523-121275545 TTCAGGAACTGGTAGTCCAAAGG + Intronic
1190039247 X:47056357-47056379 CTTATGAACTGACAGTGAAATGG - Intronic
1195845543 X:109223630-109223652 CTCCCGACCTGGCAGTAACAAGG + Intergenic