ID: 1069885836

View in Genome Browser
Species Human (GRCh38)
Location 10:71623041-71623063
Sequence TGCCACTGTGCTAGGTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069885831_1069885836 -10 Left 1069885831 10:71623028-71623050 CCAACTATGTGCCTGCCACTGTG 0: 1
1: 11
2: 164
3: 893
4: 2956
Right 1069885836 10:71623041-71623063 TGCCACTGTGCTAGGTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069885836 Original CRISPR TGCCACTGTGCTAGGTCCTG GGG Intronic
No off target data available for this crispr