ID: 1069886427

View in Genome Browser
Species Human (GRCh38)
Location 10:71626786-71626808
Sequence CCCAGTTACCACCTTCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069886427_1069886433 4 Left 1069886427 10:71626786-71626808 CCTCCATGAAGGTGGTAACTGGG 0: 1
1: 0
2: 2
3: 8
4: 122
Right 1069886433 10:71626813-71626835 GGCTAGAAAAAGGAAATGGATGG No data
1069886427_1069886432 0 Left 1069886427 10:71626786-71626808 CCTCCATGAAGGTGGTAACTGGG 0: 1
1: 0
2: 2
3: 8
4: 122
Right 1069886432 10:71626809-71626831 ATCTGGCTAGAAAAAGGAAATGG No data
1069886427_1069886431 -6 Left 1069886427 10:71626786-71626808 CCTCCATGAAGGTGGTAACTGGG 0: 1
1: 0
2: 2
3: 8
4: 122
Right 1069886431 10:71626803-71626825 ACTGGGATCTGGCTAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069886427 Original CRISPR CCCAGTTACCACCTTCATGG AGG (reversed) Intronic
901221886 1:7588049-7588071 CCCAGTGCCCACCTGCACGGTGG - Intronic
901616865 1:10547217-10547239 TCCAGTCTCCAGCTTCATGGGGG - Intronic
902644058 1:17785897-17785919 CCCAGTCACCACCTTGACTGTGG - Intronic
902808721 1:18876306-18876328 CCCAGTCACCTCCTTCATGATGG + Exonic
903308107 1:22428915-22428937 TCCAGTTACCTCCTTCTTGCCGG + Intergenic
903939891 1:26922199-26922221 CCCCGTTTCCACTTTGATGGCGG + Intronic
907649001 1:56275387-56275409 CCCACTTACCATCTTTATGATGG - Intergenic
908864863 1:68536188-68536210 CCCACTTTCCACCCTCATGTAGG - Intergenic
912483741 1:110007171-110007193 CCCAGATACCAGGTACATGGAGG - Intronic
917005246 1:170408149-170408171 CCCAGGAACCCCCTTCATTGTGG - Intergenic
921716680 1:218424158-218424180 CTTAGTTACCTCCTTCCTGGTGG - Intronic
923349037 1:233085854-233085876 CCCAGTCACCACCTTTATAAGGG + Intronic
924560787 1:245155420-245155442 CCCAGCTACCGAATTCATGGTGG - Exonic
1067027834 10:42859255-42859277 CCCAGTTGACACCTTCCTGGTGG - Intergenic
1067730964 10:48811295-48811317 CCCTGTTGCCTCCTACATGGTGG + Intronic
1068686057 10:59870842-59870864 CCCAGTGAACAACCTCATGGAGG + Intronic
1069808616 10:71142079-71142101 CCCAGGTAGCACCATAATGGAGG + Intergenic
1069886427 10:71626786-71626808 CCCAGTTACCACCTTCATGGAGG - Intronic
1070725383 10:78784121-78784143 CCCAAATAGCACCTTCTTGGTGG + Intergenic
1073558142 10:104473352-104473374 CCCAGTTGCCTCCTTCACAGTGG + Intergenic
1076186944 10:128457550-128457572 CCCATTGCCCACCTCCATGGGGG - Intergenic
1076595412 10:131622130-131622152 CCCAGCTACCAAGTTCATTGAGG - Intergenic
1076612360 10:131734284-131734306 CCTGGTTTCCACCTTCATTGGGG - Intergenic
1077286053 11:1766479-1766501 CTCAGATGCCACCTTCTTGGAGG - Intergenic
1079362057 11:19777504-19777526 CACCCTTACCAGCTTCATGGTGG - Intronic
1080742715 11:35081015-35081037 CCCAGATGCCACCTTCAATGTGG + Intergenic
1081747259 11:45481973-45481995 CCCCATTGGCACCTTCATGGAGG - Intergenic
1082638798 11:55629262-55629284 CCCAGCTTCCACCTTCAAGTAGG + Intergenic
1087102639 11:94380271-94380293 CCCAGTTCCTTCCTTCAGGGTGG - Exonic
1089668638 11:120036187-120036209 CCTCCTTACCACCTTCCTGGGGG - Intergenic
1091986196 12:4911374-4911396 CCCAGACATCACCGTCATGGTGG - Exonic
1097693998 12:62759826-62759848 CCCTGTTTCCACTTTCCTGGGGG + Intronic
1097694009 12:62759863-62759885 CCCTGTTTCCACTTTCCTGGGGG + Intronic
1099960321 12:89391011-89391033 CCCAGTCACTGCCCTCATGGAGG + Intergenic
1103070471 12:117936989-117937011 CCCAGATACCACCTTGAGGCTGG - Intronic
1108276713 13:48818419-48818441 TGAAGTTACCACCTTAATGGTGG + Intergenic
1109490093 13:63086257-63086279 ACCAGTGACCAGTTTCATGGAGG - Intergenic
1113239095 13:108316406-108316428 CCCAGCTAACACCTCCAGGGTGG - Intergenic
1113887108 13:113666751-113666773 CACAGTGACCAGCTTCCTGGGGG - Intergenic
1119126590 14:72133045-72133067 CCCAGTTTCCTTCTTCTTGGAGG - Intronic
1120193229 14:81458541-81458563 CCCAGTCACCACTGTCAAGGGGG + Intergenic
1122320080 14:100850231-100850253 CCCGGTCACCACCTTCATGCTGG - Intergenic
1123427485 15:20184085-20184107 CCCAGTTGACACCTTCCTTGTGG - Intergenic
1123536721 15:21190635-21190657 CCCAGTTGACACCTTCCTTGTGG - Intergenic
1124624268 15:31299158-31299180 CCCTGTCACCCCCTGCATGGAGG - Intergenic
1136856810 16:33665724-33665746 CCCAGTTGACACCTTCCTGGTGG + Intergenic
1137725989 16:50657074-50657096 CCCAGCTACCAGCTACTTGGAGG + Intergenic
1139939935 16:70597958-70597980 CCCAGCTACCAGCTACTTGGAGG - Intronic
1141780543 16:86157532-86157554 CCCAGAAACCACCTTCATCCAGG + Intergenic
1203118384 16_KI270728v1_random:1514199-1514221 CCGAGTTGACACCTTCCTGGTGG + Intergenic
1143172991 17:4940769-4940791 CCCACTTCCCAGCTACATGGGGG - Exonic
1143597491 17:7923956-7923978 CCCAGATCTCACCTTGATGGAGG + Exonic
1149908691 17:60550541-60550563 TCCTGTTTCCACTTTCATGGTGG + Intergenic
1157392072 18:47311271-47311293 ACTAGTTACCACCCTCTTGGTGG + Intergenic
1158496561 18:57960304-57960326 GTCAGTTACCATCTCCATGGAGG - Intergenic
1161067149 19:2244273-2244295 CCCCGACACCACCTTCCTGGTGG - Intronic
1162029207 19:7910125-7910147 GCCAGGTACCACCTTCACTGTGG + Exonic
1162779780 19:13000985-13001007 CCCAGATTCCAGCTTCATGGGGG - Intronic
1164679710 19:30125793-30125815 CCCAGTGACCACCTTCCCAGTGG + Intergenic
1165146283 19:33732869-33732891 CCATGGTACCTCCTTCATGGAGG + Intronic
1167322316 19:48804819-48804841 CCAAGTAACCAGCTTCCTGGGGG + Intronic
1167779297 19:51587246-51587268 CACATTTGCCACATTCATGGAGG - Exonic
926148519 2:10411630-10411652 CCCAGTCACCAGCTCCCTGGGGG - Intronic
929965036 2:46528394-46528416 CCCTGTTCCCACCTTCAAAGAGG - Intronic
930551477 2:52840379-52840401 CCCAGTTCCTGCCTTCAAGGAGG + Intergenic
934614605 2:95763314-95763336 CCAAGTCCCCACCCTCATGGAGG - Intergenic
935140774 2:100350990-100351012 CACAGTTACCACCTACATGGAGG + Intergenic
941643847 2:168018775-168018797 CCCAGAGACCAGCTTCATTGTGG - Intronic
942839894 2:180347774-180347796 CCAATTTACTACCTTCATTGAGG - Intergenic
942839982 2:180348661-180348683 CCAATTTACTACCTTCATTGAGG - Intergenic
947327609 2:228994732-228994754 CCCTGTAATCACCTTCCTGGTGG + Intronic
1174340429 20:49891769-49891791 CCCTGCTTCCACCTGCATGGTGG + Exonic
1174390050 20:50213518-50213540 CCCAAGCCCCACCTTCATGGCGG + Intergenic
1174708586 20:52682098-52682120 CCCACTCACCACCTTTATAGGGG + Intergenic
1180105740 21:45617050-45617072 CCCAGCAGCCACCTTCCTGGAGG - Intergenic
949608227 3:5677232-5677254 CCCGGTAACCAGCTTCATGTGGG + Intergenic
950538746 3:13597389-13597411 TCCAGTTACCACCGTCCTGATGG + Intronic
950649817 3:14400420-14400442 TCCAGTTACCAGCTCCATGAGGG - Intergenic
951681184 3:25296294-25296316 CCTAGTTACCAGCTTCTTTGGGG - Intronic
953459990 3:43074297-43074319 CCCAGTCACCACCTTTGTGATGG + Intergenic
956079816 3:65546273-65546295 CTGAGATACCACCTCCATGGGGG - Intronic
961661129 3:128469361-128469383 CCCAGGTACATCCTTCCTGGTGG + Intergenic
963042450 3:141079652-141079674 TCCAGTTTCCACTCTCATGGAGG + Intronic
964072088 3:152647186-152647208 CGCATTTGCTACCTTCATGGAGG + Intergenic
965150611 3:164969927-164969949 TCCAGTTACTACCTCCATGAAGG + Intergenic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
972995266 4:44871028-44871050 CCCAGTTACTACCTAGATTGAGG - Intergenic
976530936 4:86151148-86151170 CCCAGTTAGTTCCTTCATGAGGG - Intronic
976997280 4:91450622-91450644 CTCAGTTATCTCCTTCATTGAGG + Intronic
981261552 4:142726864-142726886 CTCAATTATCACCTCCATGGGGG - Intronic
983439223 4:167759818-167759840 CCCAATCTCCACCTTCAAGGAGG - Intergenic
984818781 4:183861901-183861923 TCTAGTTACCACCTGGATGGTGG - Intronic
986573596 5:9190348-9190370 CACAGTGCCCTCCTTCATGGAGG - Exonic
987246516 5:16054527-16054549 TCCAGCTACCACCTTCAATGAGG + Intergenic
987552695 5:19404528-19404550 CACAGTCACCTCATTCATGGAGG - Intergenic
990052953 5:51530760-51530782 CCCATTTACCACCCTCAAGTAGG - Intergenic
991663144 5:68970320-68970342 CCCAGTGACTACCTTCATGGGGG + Intergenic
992452254 5:76885410-76885432 CCCTGTTCCCACTTTCCTGGGGG - Intronic
992452291 5:76885520-76885542 CCCCGTTCCCACTTTCCTGGGGG - Intronic
992452330 5:76885631-76885653 CCCCGTTCCCACTTTCCTGGGGG - Intronic
992452357 5:76885705-76885727 CCCCGTTCCCACTTTCCTGGGGG - Intronic
993372102 5:87105528-87105550 TCCAGTTCCCACCTTCACTGTGG - Intergenic
1001588276 5:172848238-172848260 CACTGTTTCCACCTTCATGATGG + Intronic
1001978587 5:176021468-176021490 CCCAGGCACCACCTCCCTGGAGG - Intronic
1002238830 5:177822294-177822316 CCCAGGCACCACCTCCCTGGAGG + Intergenic
1003931036 6:10924918-10924940 CCCTGTTACCACCTTCTTCCTGG + Intronic
1006416588 6:33907792-33907814 CCCATTTTCCAACCTCATGGAGG - Intergenic
1008307372 6:49919466-49919488 CCAAGTTAGCACCTTCATCAGGG - Intergenic
1011899839 6:92278555-92278577 CGCTGTTACCACCTCCATGAAGG - Intergenic
1013361004 6:109393828-109393850 CCCAGTCATCACCTCCTTGGGGG + Intronic
1015313635 6:131792915-131792937 CACAGTCACCAGCTGCATGGAGG + Intergenic
1022544043 7:31168818-31168840 CACAGTCAGAACCTTCATGGGGG + Intergenic
1023577213 7:41641184-41641206 TCCAGTTACCACCCTCACAGTGG + Intergenic
1023862159 7:44223359-44223381 CCCAGTTCCCACCCACCTGGTGG + Intronic
1028565762 7:92228740-92228762 CCCAGCTTCCACCCTCAAGGAGG + Intronic
1031041044 7:116838732-116838754 CCAAGTAACCACCTTACTGGGGG + Intronic
1034265090 7:149776906-149776928 CCCCGTTTCCACCTGCTTGGTGG + Intergenic
1035115243 7:156518233-156518255 CGCAGTCACCACGTTCATGGCGG + Intergenic
1036000657 8:4599969-4599991 CACAGTGAACACCTCCATGGAGG - Intronic
1036402059 8:8417905-8417927 AGCAGTTACCACCTGCAGGGTGG - Intergenic
1039747420 8:40441591-40441613 TCCTGTCACCACCTTCATGTTGG - Intergenic
1043485092 8:80691375-80691397 ACCAGTGACCACCTTCTTGATGG + Intronic
1047176003 8:122540997-122541019 ACCAGTTTCCACATTAATGGAGG + Intergenic
1047602467 8:126439788-126439810 CCTAGTTAACACCTTCAGTGAGG - Intergenic
1047809780 8:128396134-128396156 CCCAGTTTCCACCCTTATTGAGG + Intergenic
1060470014 9:123940755-123940777 CCCAGCTCCTTCCTTCATGGAGG - Intergenic
1186182372 X:6985749-6985771 CTCAGTGCCCACCTTCCTGGAGG + Intergenic
1190744758 X:53315905-53315927 CCCAGCTGCCACCTCCATGAAGG + Intronic
1192705915 X:73528636-73528658 CCCATTTTCCACTTTCCTGGTGG + Intergenic
1192872085 X:75194519-75194541 CCCTGAAAACACCTTCATGGAGG - Intergenic
1193898830 X:87149916-87149938 CCCAGCTTCCACCTTCATGTAGG + Intergenic
1196735018 X:118975379-118975401 CCCAGTGGCCACCATCAAGGCGG - Exonic
1197773361 X:130104856-130104878 CCGAGTTGCCACCTTCTTGATGG - Intronic