ID: 1069890063

View in Genome Browser
Species Human (GRCh38)
Location 10:71646992-71647014
Sequence GAGAGGGGCAGGCGCCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069890053_1069890063 3 Left 1069890053 10:71646966-71646988 CCCTCTCCATGTGAGCACAGGCA 0: 1
1: 0
2: 4
3: 16
4: 236
Right 1069890063 10:71646992-71647014 GAGAGGGGCAGGCGCCTGGAGGG No data
1069890051_1069890063 18 Left 1069890051 10:71646951-71646973 CCTTGAGAAGGGCAACCCTCTCC No data
Right 1069890063 10:71646992-71647014 GAGAGGGGCAGGCGCCTGGAGGG No data
1069890049_1069890063 26 Left 1069890049 10:71646943-71646965 CCAGCCATCCTTGAGAAGGGCAA 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1069890063 10:71646992-71647014 GAGAGGGGCAGGCGCCTGGAGGG No data
1069890054_1069890063 2 Left 1069890054 10:71646967-71646989 CCTCTCCATGTGAGCACAGGCAC 0: 1
1: 0
2: 2
3: 14
4: 177
Right 1069890063 10:71646992-71647014 GAGAGGGGCAGGCGCCTGGAGGG No data
1069890050_1069890063 22 Left 1069890050 10:71646947-71646969 CCATCCTTGAGAAGGGCAACCCT 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1069890063 10:71646992-71647014 GAGAGGGGCAGGCGCCTGGAGGG No data
1069890055_1069890063 -3 Left 1069890055 10:71646972-71646994 CCATGTGAGCACAGGCACCAGAG 0: 1
1: 0
2: 2
3: 30
4: 306
Right 1069890063 10:71646992-71647014 GAGAGGGGCAGGCGCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069890063 Original CRISPR GAGAGGGGCAGGCGCCTGGA GGG Intronic
No off target data available for this crispr