ID: 1069898211

View in Genome Browser
Species Human (GRCh38)
Location 10:71691968-71691990
Sequence GCTCCTGAGAGCTGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 1, 1: 0, 2: 6, 3: 59, 4: 545}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069898211_1069898220 6 Left 1069898211 10:71691968-71691990 CCCTCCTCCCAGCTCTCAGGAGC 0: 1
1: 0
2: 6
3: 59
4: 545
Right 1069898220 10:71691997-71692019 CACAGTGAGCCCTCATTCCCAGG No data
1069898211_1069898221 7 Left 1069898211 10:71691968-71691990 CCCTCCTCCCAGCTCTCAGGAGC 0: 1
1: 0
2: 6
3: 59
4: 545
Right 1069898221 10:71691998-71692020 ACAGTGAGCCCTCATTCCCAGGG No data
1069898211_1069898222 8 Left 1069898211 10:71691968-71691990 CCCTCCTCCCAGCTCTCAGGAGC 0: 1
1: 0
2: 6
3: 59
4: 545
Right 1069898222 10:71691999-71692021 CAGTGAGCCCTCATTCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069898211 Original CRISPR GCTCCTGAGAGCTGGGAGGA GGG (reversed) Intronic
900189302 1:1346515-1346537 GATCCCCAGGGCTGGGAGGAGGG - Intronic
900243545 1:1627697-1627719 GCTCCTGAGTGCTGGGTGCCGGG + Exonic
900694984 1:4004239-4004261 GCTCCTGAGGGCGGGCAGCAGGG + Intergenic
900712227 1:4121756-4121778 GCTCCTTGGAGCTGAGTGGATGG + Intergenic
900726353 1:4218801-4218823 GCCCCAGAAAGCTGAGAGGAGGG - Intergenic
900830638 1:4962968-4962990 GCACTTGACCGCTGGGAGGATGG + Intergenic
900900088 1:5510144-5510166 GCCCCAGAGAGCTGGAAGGAGGG + Intergenic
900935871 1:5766170-5766192 CCTCCTGGGAGCTGGCAGTAGGG - Intergenic
901183876 1:7359697-7359719 CTTCCTGAGAGCTGGCATGAGGG + Intronic
901635021 1:10666498-10666520 GCTCCTGGGGGCTGGGAAGTGGG - Intronic
902641980 1:17772709-17772731 GCTCCAGGGAGCTGGGAGCTAGG - Intronic
902783746 1:18720217-18720239 GCATCTGAGAGCTGGGAGGAGGG - Intronic
902922021 1:19671868-19671890 CCACCTCAGGGCTGGGAGGAAGG + Intronic
903102770 1:21047454-21047476 GCTCCTGGGAGGTGGCGGGAAGG - Intronic
903438664 1:23370909-23370931 GCTCCTTGGAGCAAGGAGGAGGG + Exonic
903472774 1:23598856-23598878 GACCCTGAGGGCTGAGAGGACGG + Intronic
903616570 1:24663557-24663579 GCTCCTTAGATTTGGGGGGAGGG + Intronic
904419536 1:30382747-30382769 GTTCCTCAGGACTGGGAGGAGGG - Intergenic
904614605 1:31743067-31743089 GCTCCTGATTGGTGGGCGGATGG - Intronic
904975373 1:34452093-34452115 TCTCCTGAGTGGAGGGAGGATGG - Intergenic
905279695 1:36841255-36841277 GAAGCTGAGAGCTGGGAAGAAGG - Intronic
905510224 1:38513460-38513482 GCTCATGGGAGTTGAGAGGAGGG - Intergenic
906195711 1:43929650-43929672 GCTCCTCTGATCTGGGAGGCAGG + Intronic
906951287 1:50336178-50336200 GCTCCTGGGGGGCGGGAGGAAGG + Intergenic
907050902 1:51329645-51329667 GCCCAGGTGAGCTGGGAGGAGGG - Intronic
907377249 1:54053800-54053822 GCTCCTGAGTGCTGGGAACGAGG + Intronic
907475349 1:54701689-54701711 CCTCCTGATAGCTGGGACTATGG + Intronic
907705435 1:56828493-56828515 ACTACTGAAAGATGGGAGGAAGG - Intergenic
908930588 1:69312519-69312541 CCTGCTGAGTTCTGGGAGGAGGG - Intergenic
909522918 1:76589908-76589930 CTCCCTGAGAGGTGGGAGGAGGG + Intronic
909571938 1:77123616-77123638 GCTGCCAGGAGCTGGGAGGAGGG + Intronic
910626440 1:89313039-89313061 CCACCTGTGAACTGGGAGGATGG - Intergenic
912722037 1:112028477-112028499 GCTCCTAAGAGGTGGCAGGAGGG + Intergenic
913260021 1:116989311-116989333 TCACCTGAGGGCTGGCAGGAAGG + Exonic
915596167 1:156897656-156897678 GTTCCTGAGAGCCTGCAGGAAGG + Intronic
916548641 1:165828918-165828940 GATCCTGAGAGCTGGGTGCTGGG + Intronic
916794157 1:168150197-168150219 ACACCTGGGAGGTGGGAGGATGG + Intergenic
917611186 1:176690476-176690498 GCCTTTGAGAGCTGGGAGGGTGG + Intronic
917737751 1:177936126-177936148 ACTCCTGGGAGCTGGGCGGGAGG - Intronic
917963510 1:180164521-180164543 GGCTCTGCGAGCTGGGAGGAAGG - Intronic
918098917 1:181356831-181356853 GCTCAGGAGAGTGGGGAGGAAGG - Intergenic
918105083 1:181409986-181410008 CCTGGTGAGAGCTGGGAGGGTGG + Intergenic
919805907 1:201380947-201380969 GCTCCTATGAGCTTGGAGCATGG - Exonic
920173303 1:204084699-204084721 GGGCCTGAGAGGAGGGAGGAAGG - Intronic
920382207 1:205541717-205541739 GCTGCAGGGAGCTGGAAGGAAGG - Intergenic
920843694 1:209576050-209576072 GCTCCAGAGATCTGGGTGAAGGG - Intergenic
921267209 1:213431142-213431164 GCTCCTGAGAGATGACAGGTGGG + Intergenic
922460483 1:225811249-225811271 GCTCCCGAGATCTTGGAGGTGGG + Intronic
923410153 1:233700080-233700102 GCTCCAGAGAAATGAGAGGAAGG - Intergenic
923465373 1:234243648-234243670 ACTCCTGAGAGCTGGGGGCTTGG - Intronic
923730315 1:236543718-236543740 GGTCCTGTGAGCTGGAAGAAGGG + Intronic
924385031 1:243492216-243492238 GCGCCGGGGAGCGGGGAGGATGG - Intronic
924554485 1:245107196-245107218 GGTCCTGAGAGCAGCGAGGCAGG + Intronic
1062903825 10:1166368-1166390 GGTCCTGGGAGAGGGGAGGAGGG + Intergenic
1062931471 10:1355285-1355307 GCCCTTGGGGGCTGGGAGGATGG + Intronic
1063064342 10:2593225-2593247 ACTCCTAAGAGTTGGCAGGATGG + Intergenic
1063196143 10:3745569-3745591 ACTTCTGAGAGATGGGAGGAGGG - Intergenic
1063505502 10:6594458-6594480 GCTCCAGCAAGGTGGGAGGAAGG + Intergenic
1063510223 10:6637484-6637506 GCTCCTGCTGGCTGGAAGGAAGG - Intergenic
1063897863 10:10701169-10701191 GCTGCAGGGAGCTGGGAGAAAGG + Intergenic
1063937176 10:11090015-11090037 ACTCCAAAGAGTTGGGAGGAAGG + Intronic
1063959502 10:11295563-11295585 GCAGCAGAGAGCTGGGAGTAGGG + Intronic
1064445285 10:15387458-15387480 GGTCCTGAGAGCTGGAAGGCAGG + Intergenic
1064905676 10:20343111-20343133 GCTACTGAGATTTGGAAGGAGGG - Intergenic
1067056590 10:43056194-43056216 GCTCCTGAGAGCCTGGAAGATGG - Intergenic
1067160360 10:43820017-43820039 GCGCCTGTGAGATGGGCGGAGGG + Intergenic
1067231768 10:44417154-44417176 CCTTCTGAGAGCTGTGAGCAGGG + Intergenic
1067566085 10:47338876-47338898 GTTTCTTAGAGCTGGGAGGCAGG + Intergenic
1067929934 10:50550536-50550558 GCTGGAGAGGGCTGGGAGGAAGG - Intronic
1069175695 10:65286127-65286149 GCTCCTGAAAGCAGCCAGGAGGG - Intergenic
1069822541 10:71236577-71236599 GCTCCTCAGAGCTGGGACCCAGG + Intronic
1069898211 10:71691968-71691990 GCTCCTGAGAGCTGGGAGGAGGG - Intronic
1070058010 10:72953930-72953952 GGGACTGAGAGCTGGGAGGACGG + Intronic
1070148455 10:73791276-73791298 GCACCTGAGAGCTCAGAGAAAGG - Intronic
1070547472 10:77463911-77463933 GCTCCAGAAAGCTGGGAGGCTGG - Intronic
1070638310 10:78146946-78146968 TCTCCTGAAAGCTGGGGAGACGG - Intergenic
1070932675 10:80272260-80272282 GGTCCTGGGAGCTGGGGAGAAGG + Exonic
1071264177 10:83949472-83949494 TCTCCAGAGAACTGTGAGGAAGG - Intergenic
1071265152 10:83958143-83958165 GCTCCCGAGAGCTGGGCACATGG - Intergenic
1071505516 10:86229259-86229281 GCTCCTCTGCCCTGGGAGGAGGG - Intronic
1072631174 10:97147617-97147639 GGTTCAGAGAGCTGGGAGGGGGG + Intronic
1072739909 10:97903125-97903147 GCTCCTGAGAGCTCTGGGGAGGG + Intronic
1073185420 10:101612689-101612711 GCTGCTGAGGGCTGGGATGCTGG - Intronic
1074978150 10:118597344-118597366 GAGGCTGAGAGGTGGGAGGATGG - Intergenic
1075315419 10:121449346-121449368 GCATCTGAGAGCTGTGAGGGAGG - Intergenic
1076217314 10:128706314-128706336 CCACCTGAAAGCTGGGAGAATGG + Intergenic
1076822533 10:132946628-132946650 GATCCTGAGTGCTGGGTGCAGGG - Intergenic
1076998403 11:310567-310589 GCTCCAGACAGCTCGGAGGCAGG - Intronic
1077000340 11:319192-319214 GCTCCAGACAGCTCGGAGGCAGG + Intergenic
1077102264 11:827526-827548 GCCCCAGGGAGGTGGGAGGATGG - Intronic
1077181352 11:1218632-1218654 GCTCCTTGGAACTGGCAGGAAGG + Intergenic
1077208304 11:1354636-1354658 GCCCCTGCCAGCTGGGAGGCCGG + Intergenic
1077240668 11:1508815-1508837 ACTCCAGAAGGCTGGGAGGAAGG + Intergenic
1077246342 11:1541096-1541118 TCTTCTGAGGGCTGTGAGGAAGG - Intergenic
1077370584 11:2179895-2179917 GCTCCTGAGGGCGGGAAGGGAGG + Intergenic
1077760385 11:5089164-5089186 GCACCTGTGAGCTGGGAGACAGG - Intergenic
1079110388 11:17602061-17602083 GTCCCTGAGATCTGGGATGAAGG + Intronic
1081850518 11:46272297-46272319 GCATTTCAGAGCTGGGAGGATGG + Intergenic
1083055963 11:59820018-59820040 GCTTCTAAGGGCTGTGAGGAAGG + Intergenic
1083499229 11:63088002-63088024 GCTCTTCAGAGCTGGCAGGCAGG - Intronic
1083646482 11:64174284-64174306 GGACCTGAGAGCTGGAGGGACGG - Intergenic
1083647609 11:64181764-64181786 GTTCCAGGGACCTGGGAGGAGGG + Intergenic
1084526257 11:69699982-69700004 GAGGCTGAGAGGTGGGAGGATGG + Intronic
1084569742 11:69952071-69952093 TCTCCTGTCAGCTGGGAGGTGGG + Intergenic
1084641766 11:70430502-70430524 GGTCCTGAGAGGAGGGAGGCAGG - Intronic
1084710389 11:70840456-70840478 GCTCCTCAGAGCTGAGAGGGGGG - Intronic
1084751315 11:71205867-71205889 GCTGCTGAGATCTGGGAGAAAGG + Intronic
1084944648 11:72632103-72632125 CCTTCTGTGAGCTGGGGGGAGGG + Intronic
1085754723 11:79193018-79193040 GGTCCTGGGCGCTGGGAGGCTGG - Intronic
1085851348 11:80124208-80124230 GGCCCTGAGACCTAGGAGGATGG + Intergenic
1086497703 11:87421348-87421370 GGTCCAGAGAGCTGGCAGGCAGG + Intergenic
1087118364 11:94546250-94546272 GCTCCTGAGAAAGGTGAGGAGGG + Exonic
1088000656 11:104876290-104876312 ACATCTGAGTGCTGGGAGGATGG + Intergenic
1088579173 11:111299479-111299501 ACCCCTGAGCGCTGGGAGCAGGG - Exonic
1088770613 11:113032321-113032343 GCCCCTGAGATCTGGGTGGAAGG - Intronic
1088903587 11:114137332-114137354 CCTCCTGAGAGCTAGGGAGAGGG - Intronic
1088919701 11:114252033-114252055 GTTCCTGCCAGCTGGGAGGCTGG - Intergenic
1089008745 11:115114701-115114723 GCACCTGAGAGCTGTGATGGAGG + Intergenic
1089602288 11:119623469-119623491 GCTCTGGAGGTCTGGGAGGAGGG + Intronic
1089712378 11:120325208-120325230 GCACCTGCTGGCTGGGAGGATGG - Intronic
1090239129 11:125169778-125169800 ACTCCTGAGAGTTGTGGGGAAGG - Intronic
1091721937 12:2820252-2820274 GCCCCAGGGAGCTGGGAGGAAGG + Intronic
1092236627 12:6814631-6814653 GCAGCTGGGTGCTGGGAGGAAGG + Intronic
1092332199 12:7594806-7594828 TCTCTTGAGAGCTGTGAGGCAGG - Intergenic
1092755649 12:11760731-11760753 GCTCCTGTGAGCTGGCAGGTAGG - Intronic
1094484063 12:30910086-30910108 GCTCCTGGGAGCTGGGAGCCAGG - Intergenic
1095239408 12:39839126-39839148 GCTGGTGAGAGCAGTGAGGAAGG - Intronic
1096382705 12:51172641-51172663 GTTCCTGAGAGCTGGGCAGGGGG - Exonic
1096441522 12:51647561-51647583 GTCCCTGAGACCTGGTAGGAGGG + Intronic
1096464793 12:51842343-51842365 CCTCCAGAGAGCAAGGAGGAAGG + Intergenic
1096674100 12:53217282-53217304 GGTGCTGAGAGATGTGAGGAGGG + Intronic
1096869837 12:54586396-54586418 GCTCCTGAGAGCTAGGATTTGGG - Intronic
1097009446 12:55941745-55941767 GGGCCAGAGAGCTCGGAGGATGG - Intronic
1097287478 12:57889153-57889175 CTTCCTGGGAGCTGGGTGGAGGG - Intergenic
1097990345 12:65825908-65825930 GCCACCGAGAGCTTGGAGGAGGG - Intronic
1100981650 12:100166964-100166986 GCTCCAGGGAGGTGGGTGGATGG - Intergenic
1101289360 12:103352022-103352044 GCTCCTGGGAGCTTGGAGCAGGG - Intronic
1101409448 12:104456894-104456916 CCTGCGGAGAGCCGGGAGGAGGG - Intronic
1101487944 12:105184802-105184824 TCTCTTGAGAGCTGGCAGGCAGG + Intronic
1102230884 12:111261412-111261434 GCTCCTGTGAGCCCTGAGGAGGG - Intronic
1102531994 12:113553482-113553504 GTTCCTGAGACCCCGGAGGAGGG - Intergenic
1102932914 12:116876337-116876359 GGTGCTGCGAGCTGGGAGGGAGG + Intronic
1103447754 12:121005352-121005374 GCACCTGGCACCTGGGAGGAGGG - Intronic
1103758721 12:123232695-123232717 GCTACGGAAAGCAGGGAGGACGG + Intronic
1103967772 12:124651150-124651172 GCCCCTGGGAGCTGAGAGGAAGG + Intergenic
1104212786 12:126706249-126706271 ATGCCTGAGAGCTGGGAAGAAGG + Intergenic
1104423108 12:128653250-128653272 GTTGCTGGGGGCTGGGAGGAGGG + Intronic
1104655694 12:130572392-130572414 GCTCATGCGAGCCGGGAAGAAGG - Intronic
1104980388 12:132570837-132570859 GGTCCTGAGCCCTGGGAGGAGGG + Intronic
1106391111 13:29336687-29336709 TCTCTTCAGAGCTGGCAGGAAGG + Intronic
1106652989 13:31711822-31711844 TCTCATGAGAGATGGGAGAAGGG - Intergenic
1106936884 13:34732257-34732279 GCTCTTGAGGGCAGGGATGATGG - Intergenic
1107477554 13:40753706-40753728 GCTGCTTAGAGATGGGAGGCAGG + Intronic
1107805926 13:44153892-44153914 GGCCCTGAGGCCTGGGAGGAAGG - Intronic
1111976195 13:94968671-94968693 GCTCCCGGGAGCTTGGAGGGCGG - Intergenic
1112000368 13:95204056-95204078 GCTCCTGAGACCTGGCCGGAGGG + Intronic
1113268079 13:108641695-108641717 GCTCATGAGTGCTGTGTGGAAGG - Intronic
1113437140 13:110302001-110302023 GAGCACGAGAGCTGGGAGGAGGG + Intronic
1113580190 13:111423139-111423161 GCTCCGGAGGGCAGGGGGGAGGG + Intergenic
1113849308 13:113408972-113408994 GCTGCAGAGAGGAGGGAGGAGGG + Intergenic
1114162143 14:20179888-20179910 GGTCCTGAGAGCTGTGTTGAGGG + Intergenic
1114512902 14:23277077-23277099 GCTCCTCAGAGATTGGAGGGAGG + Exonic
1114672358 14:24418049-24418071 GCCCTTGAGGCCTGGGAGGATGG - Exonic
1114702760 14:24695501-24695523 ACTGCTGTGAGCTGGGAGGAAGG + Intergenic
1115156357 14:30344002-30344024 GAGGCTGAGAGGTGGGAGGATGG - Intergenic
1115353514 14:32422780-32422802 GCTCCTGGGAGCTGGGGCAAAGG + Intronic
1115511330 14:34140233-34140255 TCTCCTCAGAGCTGGCAGGCAGG - Intronic
1115586419 14:34818311-34818333 GTTCCTAGGGGCTGGGAGGAGGG + Intronic
1115754951 14:36520481-36520503 GGCCCCCAGAGCTGGGAGGATGG + Intronic
1117869905 14:60189390-60189412 GCGGCTGAGAGCTGGGATGCTGG + Intergenic
1118259323 14:64232972-64232994 ACTCCTGAGAGTTGGGAAGGTGG + Intronic
1118509283 14:66452990-66453012 TCTTCTGAGAAGTGGGAGGAGGG - Intergenic
1119672061 14:76527509-76527531 GCTCCTGACAGCATGCAGGATGG - Intergenic
1119725616 14:76920355-76920377 GCATCGGGGAGCTGGGAGGAGGG - Intergenic
1120315110 14:82882265-82882287 GCTACTCAGAGCCGGGAGGCTGG - Intergenic
1121033851 14:90682767-90682789 GCTCCCAAGAGCTGGCAGGCTGG + Intronic
1121663047 14:95650130-95650152 GGTCCTGGCAGCTGGGTGGATGG + Intergenic
1122271225 14:100569143-100569165 TCACCTGAAAGCTGGGGGGAAGG + Intronic
1122354159 14:101113283-101113305 GAAGCTCAGAGCTGGGAGGATGG + Intergenic
1122355570 14:101121152-101121174 TCCCCTGAGCCCTGGGAGGACGG - Intergenic
1122361550 14:101169903-101169925 GCTTCTGAAAGATGGGAAGAAGG - Intergenic
1122389007 14:101367742-101367764 GCTGCTGGGAGCCAGGAGGATGG + Intergenic
1122810884 14:104287343-104287365 GTGCCTGAGAGCTGGGACCATGG - Intergenic
1122823855 14:104360221-104360243 GCTCCACAGAGCTGGGAGGACGG + Intergenic
1122960710 14:105092613-105092635 GCTCCTGAGAGGCAGGAGGATGG + Intergenic
1122978093 14:105179207-105179229 GCTGCTGAGGCCTGGGAGGGAGG + Intronic
1123032234 14:105457396-105457418 TCTTCTGGGAGCTGGGACGATGG - Intronic
1123578768 15:21697532-21697554 AGTCCTGAAAGCTGGGATGAGGG + Intergenic
1123615395 15:22140014-22140036 AGTCCTGAAAGCTGGGATGAGGG + Intergenic
1124067034 15:26354230-26354252 GGTCCTGATAACTGGGTGGAGGG - Intergenic
1125500622 15:40238570-40238592 GCTCCGGGGAGCTGGCAGGGGGG + Intergenic
1125888679 15:43249431-43249453 GTTGCTTAGGGCTGGGAGGAGGG - Intronic
1126430439 15:48577836-48577858 GCACCTGAGACCTTGTAGGAAGG - Intronic
1126868754 15:52964763-52964785 CCTCCTTAGAGTTGTGAGGAGGG + Intergenic
1126917484 15:53482255-53482277 GCTCATGAGTGATGGGATGATGG - Intergenic
1127368206 15:58310839-58310861 GCTTCTGTGCGCTGGGAGGCTGG - Intronic
1127433307 15:58933245-58933267 GCTCCCGCGAGCGTGGAGGACGG - Intronic
1127606465 15:60592325-60592347 GCTCCGGGGGGCGGGGAGGAGGG - Intronic
1127759631 15:62125859-62125881 GGCCCAGAGAGCTGGGAGTAGGG + Intergenic
1127761871 15:62147323-62147345 GGGCCTGAGAACTGGGAGCAAGG - Intergenic
1127831195 15:62753043-62753065 TCTCCTGAGATCTGAGGGGAAGG - Intronic
1128065376 15:64761301-64761323 GCTACTGAGGGCTGGGAGTTGGG - Intronic
1128088654 15:64904208-64904230 GCACCTAAGAGCTGGCAGGCTGG - Intronic
1128091266 15:64920389-64920411 GCTCCAGAGAGTTGGTGGGATGG + Intronic
1128098663 15:64979361-64979383 GCTGCAGAGGGCTGGGATGAGGG + Intronic
1128657370 15:69472253-69472275 GGTACTGAGAGCTGGGTGGCAGG - Intergenic
1129413652 15:75362900-75362922 ACTCCAGCGAGGTGGGAGGAGGG + Intronic
1130577562 15:85105910-85105932 GCTTCTGAGAGCTGGGTGCTGGG + Intronic
1130863209 15:87909263-87909285 GCTCCTGAGAAGTGAGAGGAGGG + Intronic
1131385764 15:92005631-92005653 CCTCTAGAGAGCTGGGGGGATGG + Intronic
1202987638 15_KI270727v1_random:431777-431799 AGTCCTGAAAGCTGGGATGAGGG + Intergenic
1132490620 16:228734-228756 TCTCCTGTGTGCTGGGGGGAAGG + Intronic
1132835463 16:1950775-1950797 GCTCCTGGAAGCTGGGGTGAGGG + Intronic
1132935884 16:2480820-2480842 GCCCCTGAGTGCTGGGAACATGG - Intronic
1133620080 16:7518064-7518086 CGTCCTGGGATCTGGGAGGAAGG + Intronic
1133975075 16:10594841-10594863 GCACCTGGGAGGTGGGAGGATGG - Intergenic
1133983811 16:10653010-10653032 GCCCCTCAGAGCTTGGGGGATGG - Intronic
1134505781 16:14805726-14805748 GCTCCTGTGAGCAAAGAGGATGG + Intronic
1134561117 16:15210713-15210735 GAGGCTGAGAGGTGGGAGGACGG - Intergenic
1134574800 16:15323221-15323243 GCTCCTGTGAGCAAAGAGGATGG - Intergenic
1134727645 16:16433253-16433275 GCTCCTGTGAGCAAAGAGGATGG + Intergenic
1134921654 16:18122333-18122355 GAGGCTGAGAGGTGGGAGGACGG - Intergenic
1134939787 16:18278574-18278596 GCTCCTGTGAGCAAAGAGGATGG - Intergenic
1136085241 16:27880227-27880249 GCTGCTGAGAGCTGGGCGTCTGG - Intronic
1136298355 16:29316649-29316671 GTGACTGAAAGCTGGGAGGAAGG + Intergenic
1137502733 16:49023975-49023997 GCTCCTGGGAGCTGGCAGGAGGG + Intergenic
1137712116 16:50573637-50573659 CTTCCTGAGGGCTAGGAGGAGGG + Intronic
1138237019 16:55392471-55392493 TCTTCTGAGGGCTGTGAGGAGGG - Intronic
1138628192 16:58269496-58269518 GCTGCTGAGAGCTGGAGGGTGGG - Intronic
1139431748 16:66914408-66914430 GCTCCCTAGAACAGGGAGGATGG + Exonic
1139651249 16:68363326-68363348 GCTTTTGAGAGCTGGGAGCTGGG - Intronic
1140350531 16:74257976-74257998 GAGGCTGAGAGGTGGGAGGACGG + Intergenic
1140818378 16:78641070-78641092 ACTCCTCAAAGCTGAGAGGAGGG + Intronic
1141646767 16:85371725-85371747 GGCCCAGTGAGCTGGGAGGATGG - Intergenic
1141811542 16:86379357-86379379 GGCCAGGAGAGCTGGGAGGAGGG + Intergenic
1142027569 16:87822779-87822801 ACTCCTGACAGCTGGGAGAGAGG - Intergenic
1142060015 16:88023154-88023176 GTGACTGAGAGCTGGGAGGAAGG + Intronic
1142147231 16:88497692-88497714 GCTGCTGTGAGGCGGGAGGAGGG + Intronic
1142509942 17:386738-386760 GCTCCTGGGGGCTGGGGGGTGGG - Intergenic
1142813966 17:2411025-2411047 CCTCTGGAGAGCTGGGTGGATGG + Intronic
1142903432 17:3027173-3027195 GGGCCTCACAGCTGGGAGGAGGG - Intronic
1143152607 17:4816769-4816791 GCCCCAGAGAGCTGAGAGCAGGG + Intronic
1143179448 17:4974975-4974997 GCTGCGGGGGGCTGGGAGGAAGG - Intronic
1144856963 17:18274582-18274604 ACTCCTGAGGCCTGGGAAGAGGG + Exonic
1145830689 17:27913853-27913875 GCTGCTGAGAGGTGGGAGTGGGG - Intergenic
1146666264 17:34706229-34706251 GCTCCTGACAGCCGGGAGAAGGG + Intergenic
1146924274 17:36733304-36733326 GCTCCTGCAACCTGGGAGTAAGG - Intergenic
1147213423 17:38885497-38885519 GCAGCTGATAGCAGGGAGGAAGG + Intronic
1147239397 17:39080649-39080671 GCTCCAGAGAGCTTGTAAGAAGG + Intronic
1147572432 17:41579646-41579668 GGTTCTGAGTGCTGGGAGGGTGG + Intergenic
1147869050 17:43574429-43574451 GCTCCTGCTAACTGGCAGGACGG - Intronic
1147949897 17:44101454-44101476 GCCCCAGAAAGCTAGGAGGAGGG + Intronic
1148431846 17:47649607-47649629 CCGGCTGAGCGCTGGGAGGAGGG - Intronic
1148623773 17:49053787-49053809 CCTGATGAGAGGTGGGAGGAAGG - Exonic
1148847500 17:50537978-50538000 GCTCAAGAGAACTGAGAGGAGGG - Intronic
1148851504 17:50557751-50557773 AGCCCTGAGAGCTGGGTGGATGG - Intergenic
1149328328 17:55555842-55555864 GCCCCTGAGAGCTTAGAGCAGGG - Intergenic
1150204163 17:63388666-63388688 GATCCAGAGACCTTGGAGGATGG - Exonic
1150461378 17:65356563-65356585 GCTCAGGAGACCTGGGAGGTAGG - Intergenic
1150472416 17:65448443-65448465 GCTCCTAAGGGCTGGGAGGATGG - Intergenic
1150479592 17:65499184-65499206 CCTCCTGAGGGTTGGGAGGAGGG - Intergenic
1150520805 17:65865591-65865613 GCTCCTGAGACCTATGGGGAGGG - Intronic
1150732065 17:67704333-67704355 GCTTTTGGGGGCTGGGAGGAGGG - Intergenic
1150748772 17:67840205-67840227 GAAGCTGAGAGGTGGGAGGATGG - Intronic
1150839129 17:68591722-68591744 GCGCCTGCGCACTGGGAGGATGG + Intronic
1151294769 17:73176716-73176738 TCTCCTGAGAACTGGGATGCTGG - Intergenic
1151778666 17:76227013-76227035 GACCCTGAGGGCGGGGAGGAGGG + Intronic
1151873426 17:76851838-76851860 ACTGCTGAGATCTGGGATGATGG + Intergenic
1152094113 17:78263265-78263287 GCTGCTGACAGCTGGGACGCTGG + Intergenic
1152408816 17:80111899-80111921 GCTCCTGGGAGGTGGGGGGCAGG + Intergenic
1152638017 17:81438087-81438109 GATCCTGAGTGCTGCTAGGAGGG + Intronic
1152786222 17:82249401-82249423 GCCCCAGAGCGCTGGGAGGGGGG + Intronic
1152983576 18:302096-302118 CCTCCTGAGAGCCGGGATTACGG + Intergenic
1153485681 18:5595453-5595475 GCTCCTGCTTGCTGAGAGGATGG - Intronic
1153767226 18:8386009-8386031 TGTCCTGAGAGCTAGGATGATGG + Intronic
1154191208 18:12232172-12232194 CTTCCAGAGAGCTGTGAGGAAGG - Intergenic
1154998811 18:21666819-21666841 TCACTTGAGATCTGGGAGGAGGG + Intronic
1155160604 18:23192492-23192514 GCAGCTGGGAGGTGGGAGGAAGG + Intronic
1155250970 18:23953063-23953085 GCTCTTGAGTGCTGGCAGGTGGG - Exonic
1156249985 18:35343890-35343912 GGTCCTGAGTGCTGGGAAGAGGG - Intronic
1156465719 18:37346956-37346978 GCCTCTGAGAACAGGGAGGAGGG + Intronic
1156504843 18:37583764-37583786 GCTCCTTGGGGCAGGGAGGATGG - Intergenic
1156962840 18:43053579-43053601 TGTCTGGAGAGCTGGGAGGAAGG + Intronic
1157096074 18:44686459-44686481 GGAGCTGAGAGCTGGGAAGAAGG - Intronic
1157105410 18:44770072-44770094 TCTCAAAAGAGCTGGGAGGAGGG - Intronic
1157273669 18:46294998-46295020 GGTCCTGGGAGCTTGCAGGAAGG + Intergenic
1157516397 18:48314771-48314793 ACTGCTGACAGCTGGGAGAAGGG + Intronic
1157589718 18:48829058-48829080 GCTGCTGAAGGCTTGGAGGAGGG + Intronic
1158889292 18:61858403-61858425 GGTCCAGAGAGCTTGGGGGAGGG - Intronic
1159931350 18:74315805-74315827 GCTCCCGAGGGCTGTGAGGAGGG + Exonic
1159931370 18:74315879-74315901 TCTCCTGAGGGCAGCGAGGAGGG + Exonic
1160044034 18:75370501-75370523 CCTGCTGATAGCTGGGAGCACGG + Intergenic
1160429957 18:78804385-78804407 GCTCAGCAGAGCTGGCAGGAGGG - Intergenic
1161447237 19:4325357-4325379 GCTGCTGAGAGCTGGGGGTTGGG - Intronic
1161512558 19:4679662-4679684 GGCCCTGGGAGCTGGGAGGGCGG + Intronic
1161519000 19:4713278-4713300 GGCCTTAAGAGCTGGGAGGAAGG - Intronic
1161575426 19:5052037-5052059 CCTCCTGAGTGCTGCGGGGAGGG + Intronic
1161940921 19:7403359-7403381 GCTGCTGGGGGCTGGGAGGATGG - Intronic
1161990470 19:7681492-7681514 GGTTCTGAAGGCTGGGAGGAGGG - Intronic
1162561808 19:11421631-11421653 GCTCCAGAGATCTAGGAGTAGGG - Intronic
1162742920 19:12783384-12783406 CTTCCTGTGGGCTGGGAGGAGGG - Intronic
1163812157 19:19440082-19440104 GCCCCTGAGTGAAGGGAGGAAGG + Intronic
1164668383 19:30058503-30058525 GCTGTTGAGAGCTGGGCTGAAGG + Intergenic
1165104421 19:33460596-33460618 GCCCCTGAGAGCTTAGAGCAGGG - Intronic
1165158496 19:33802390-33802412 GTTCCTCAGAGCAGGGAGGATGG + Intronic
1165244833 19:34492959-34492981 GGTGCTGAGAGCTGGAAGCACGG + Intronic
1165359732 19:35328910-35328932 TTTCCTGAGAGCTGGGTAGAGGG + Intronic
1166082125 19:40450652-40450674 GCTACTGGGAGGCGGGAGGATGG - Intronic
1166377665 19:42336735-42336757 GCTCCTAAGAGCCTGGAGGAGGG + Intronic
1166546171 19:43635901-43635923 GCTCCTGGGTCCAGGGAGGAGGG - Intronic
1167042253 19:47028931-47028953 GCTCCTGACTGTAGGGAGGATGG + Intronic
1167208197 19:48116570-48116592 GCTCCTGAGAGTTGGGAGCTGGG - Intronic
1167353848 19:48991860-48991882 GCTCCTGTGAGCTGGGAACTCGG - Intronic
1167648836 19:50719122-50719144 GCCCCGGAGAGCCGGGAGGCGGG + Intronic
1168100515 19:54138586-54138608 GCTCCCGGGAGCAGTGAGGAGGG - Intronic
1168524306 19:57076550-57076572 GATTCTGAAAGCTGGGAGTAGGG - Intergenic
1168652457 19:58100370-58100392 ACATCTGAGTGCTGGGAGGATGG - Intronic
924979889 2:209970-209992 TCTGCTGAGAGATGGGTGGATGG + Intergenic
925013206 2:501675-501697 GCCTCTGAGGGCAGGGAGGAGGG - Intergenic
925329636 2:3048609-3048631 GCTCATGAGTGGTGGGAGGTAGG - Intergenic
925692400 2:6538275-6538297 TCTCTTCAGAGCTGGCAGGAAGG - Intergenic
926058692 2:9791966-9791988 GCCCCTGAGATGGGGGAGGAGGG + Intergenic
926918335 2:17914903-17914925 GATTCTGAGACCTGGGAGAATGG + Intronic
926929562 2:18023524-18023546 GCCCATGAGAGCTGCCAGGAAGG - Intronic
927875874 2:26654893-26654915 GCTCATGGGAGCGGGGAGGTGGG + Intergenic
928936182 2:36680607-36680629 GCTGCTGTGAGCTGGGGGTAGGG - Intergenic
929127165 2:38532666-38532688 GCTCCTGAGGGCGTGCAGGATGG - Intergenic
929578852 2:43069257-43069279 GCTGGTGAGAGCTGGGTGGCGGG - Intergenic
929933068 2:46273562-46273584 TCTCCAGAGAGCTGGGTGGGTGG - Intergenic
930724822 2:54672807-54672829 GATCCAGAGAACTGGGAGGCGGG - Intergenic
930815826 2:55597038-55597060 GTTACTAAGAGCTGGAAGGAGGG + Intronic
931648037 2:64443154-64443176 GTTGCTGAGAGCTAGGGGGAGGG - Intergenic
932754023 2:74392491-74392513 GAGGCTGAGAGGTGGGAGGATGG - Intergenic
933256597 2:80087995-80088017 GCCCCTGAGAACTGGGTGGTCGG - Intronic
933488237 2:82950122-82950144 TCTCTTCAGAGCTGGGAGGCAGG + Intergenic
933695409 2:85213768-85213790 ACTCCTGGGTGCTGGGAGGAGGG - Intronic
935123640 2:100203251-100203273 GGTCCTTGGAGCTGGGAGGGTGG - Intergenic
936077171 2:109408898-109408920 GCGAGTGAGAGCTGTGAGGAAGG + Intronic
936080412 2:109429094-109429116 GACCCTGAGAGGTGGGAGGGAGG + Intronic
936515685 2:113180063-113180085 GCACCTGAGAGAAGGAAGGAGGG - Intronic
937344941 2:121119619-121119641 GCCCCTGAGAGATGTGAGGATGG - Intergenic
937436466 2:121885776-121885798 GCTTCTGAGAGCCACGAGGAAGG + Intergenic
937884350 2:126889835-126889857 GATCCTGGGAGCTTGGAGCATGG - Intergenic
938690868 2:133787870-133787892 CATCCTGACATCTGGGAGGATGG - Intergenic
941077100 2:161018098-161018120 GCTCATGAGACTTGGCAGGAGGG + Intergenic
945013004 2:205484874-205484896 GCTACTGAGAGCTGGAGGAAGGG + Intronic
945409231 2:209488881-209488903 CCTCCTCAGAGCTGGCAGGCAGG - Intronic
945983742 2:216338402-216338424 GCTACGTGGAGCTGGGAGGAAGG - Intronic
946427876 2:219609013-219609035 GATGCTGAGAGCATGGAGGATGG - Intronic
946652964 2:221913926-221913948 TCTCCTGTGCACTGGGAGGATGG - Intergenic
947576836 2:231281926-231281948 GCACAGGAGAGCTGCGAGGACGG + Intronic
947611563 2:231528045-231528067 GCTCCTGGGGCCTGGGAGAAGGG - Intronic
947944939 2:234093282-234093304 GTTGCTGAGAGCTAGGAGGGAGG + Intergenic
948777497 2:240297264-240297286 GCTCCTGTGAGCCTGGAGGAGGG - Intergenic
948831617 2:240601116-240601138 GCTCCTGAGGGCCTGGGGGAAGG - Intronic
1168907930 20:1421871-1421893 CATCCGGAGAGCGGGGAGGATGG - Intergenic
1169371341 20:5030564-5030586 CCTCCTGAGAGCTTGGATGCAGG - Intergenic
1169417670 20:5431797-5431819 GCTCTTGTGTGCTGGGAGGCTGG - Intergenic
1169421280 20:5462944-5462966 TCTCCTCAGAGCTGGCAGGCAGG + Intergenic
1172095122 20:32456767-32456789 GGTCCTGGGAGCTGGGGAGAAGG - Intronic
1173031434 20:39364854-39364876 GCACCTGAGAGATGGAAAGAAGG + Intergenic
1173857212 20:46258200-46258222 GTTCAAGAGAACTGGGAGGAGGG + Intronic
1173936717 20:46872725-46872747 GCTCCTGAGTGCTGAATGGAAGG + Intergenic
1174080922 20:47970310-47970332 TGGCCTGAGAGCTGGGAGGGTGG - Intergenic
1174146604 20:48456511-48456533 GCCCCTGAGAGCCAGGAGGGCGG - Intergenic
1174623376 20:51894348-51894370 CTTCCTGAGTGCTGGGATGATGG + Intergenic
1175321414 20:58090811-58090833 GCTCCTGGGTCCTGGGAAGAGGG - Intergenic
1175633579 20:60561879-60561901 GCTCCTGGGAGCAGGGATAAAGG - Intergenic
1175662870 20:60832105-60832127 TCTACAGAGAACTGGGAGGAAGG - Intergenic
1175743177 20:61435223-61435245 ACTCCTGAGCGCTGTAAGGATGG - Intronic
1176225954 20:63999533-63999555 GCACCCGAGACCTGGGATGAGGG - Intronic
1177050328 21:16225196-16225218 TCTCTTCAGAGCTGGCAGGAAGG - Intergenic
1178615030 21:34125065-34125087 GCTCCAGGGATCTGGGAGGCAGG - Intronic
1178966653 21:37126454-37126476 GCTCCTAGCAGGTGGGAGGAAGG - Intronic
1179143006 21:38743880-38743902 GCTTCTGAGAGAAGGGAGGAAGG - Intergenic
1179605816 21:42514388-42514410 GGTCCAGAGAGCCGGCAGGAGGG + Exonic
1179793410 21:43768537-43768559 GCCCCTGAGAGCCGGCTGGAAGG - Intergenic
1179926767 21:44539145-44539167 GCTCCTGGGAGCAAGGAGGGGGG + Exonic
1180593477 22:16959441-16959463 GCCCCTGAGGCCTGGGACGATGG - Intergenic
1181313200 22:21956561-21956583 GCTTCTCAGAGATGGGAGCAGGG + Intergenic
1181346306 22:22222633-22222655 GCTTCTCAGAGATGGGAGCAGGG + Intergenic
1181483705 22:23217804-23217826 GCTCGTGAGACCTGGAGGGAGGG + Intronic
1181496385 22:23289505-23289527 GCTTCTGAAACCTGGGAGGTTGG - Exonic
1181917785 22:26294280-26294302 ACTGCAGAGAGCTGGAAGGAAGG - Exonic
1182482291 22:30617032-30617054 GTGCCAGAGAGGTGGGAGGAAGG + Intronic
1182574912 22:31266523-31266545 TCTGCTGAGAACTGGGAGGGGGG + Intronic
1182892463 22:33830373-33830395 TCACCTGTGAGCTGGAAGGAAGG - Intronic
1183024934 22:35058010-35058032 TCTGCTGAGAGCTGAGATGATGG - Intergenic
1183167515 22:36159087-36159109 GCTCCTCAGAGCTCAGATGACGG - Intronic
1183713528 22:39520615-39520637 GACCCTGAGGGCGGGGAGGAGGG - Exonic
1183737214 22:39650733-39650755 CCTCCTGTGGGCTGGGAGCAGGG + Intronic
1184004299 22:41697326-41697348 GGTCCTGGGAGCTGGGAGCTTGG - Exonic
1184314213 22:43671085-43671107 GCTCCTGAGAGGTGAGAGGCTGG + Intronic
1184351230 22:43945500-43945522 GCTCCTGAGAGCCCGTAGCATGG + Intronic
1184427832 22:44423550-44423572 GGGCCTGAAAGCTGGGAAGATGG + Intergenic
1184473815 22:44710286-44710308 CCTCCTGAGCGCTGGGGGGGGGG - Intronic
1184754811 22:46509741-46509763 GCCTCAGGGAGCTGGGAGGAGGG + Intronic
1185178664 22:49346882-49346904 GTCCCAGACAGCTGGGAGGATGG + Intergenic
1185371650 22:50463651-50463673 GCACCTGTGAGCTGGCAGGGAGG + Intronic
949440196 3:4071888-4071910 GCTCTTCAGAGCTGTGAGGCAGG - Intronic
950374318 3:12557420-12557442 GCCCCTGTGGGCTGGGAGGAAGG + Intronic
951326598 3:21309624-21309646 GTTCCTGGGGGCTGGGAGGCAGG + Intergenic
952455187 3:33466001-33466023 GCTACTGACAGCAGGGAGAAAGG - Intergenic
952514586 3:34091126-34091148 GCTCCAGAGAATTGGCAGGAAGG - Intergenic
952620969 3:35342162-35342184 GCTCCTGACAGCTTGGTGGTGGG - Intergenic
952874117 3:37927850-37927872 GCTGCCAAGGGCTGGGAGGAGGG - Intronic
952919543 3:38275394-38275416 GCTCCTGACCCGTGGGAGGATGG + Exonic
953007443 3:38991363-38991385 GATTCTGTGAGCTGGCAGGAGGG - Intergenic
953344008 3:42160124-42160146 GCTCCTATGAGCCTGGAGGAGGG - Intronic
953358704 3:42276376-42276398 GCTTCTGAGTGCTGGGTGCAGGG + Intergenic
953374088 3:42413953-42413975 GCTCTTGAGAGCAGGCAGCAGGG - Intergenic
953680411 3:45034824-45034846 TCTCCTGAGGGCTGGTAGGGTGG - Intronic
953833555 3:46323743-46323765 GCTTTGGAGAGCTGAGAGGAGGG - Intergenic
953843304 3:46407020-46407042 GCTACTGTCAGCAGGGAGGAAGG - Intergenic
954291035 3:49650137-49650159 AGACCTGAGAGCTGGGAGGCAGG + Intronic
956406280 3:68932081-68932103 GCCCCAGAGAGCCGGGATGAGGG + Intronic
957394022 3:79617053-79617075 GCTCATGAGCCCTGGGATGAGGG + Intronic
957457621 3:80472685-80472707 GCTGCACAGAGCTGGGAGGTGGG - Intergenic
958112861 3:89172330-89172352 GCCATTGAGAGCTGGGAAGAGGG + Intronic
960554833 3:119016241-119016263 GGTCCTGGGAGCTGGGAAGCTGG + Intronic
961056452 3:123793024-123793046 GCTCCTGAAAGCTTGTAGGAGGG - Intronic
961153910 3:124662828-124662850 CCTCCTGAGAGCTGTGAGGGAGG + Intronic
961494112 3:127278448-127278470 GCTCCTGTGAGCTGGAGGGAGGG + Intergenic
961566061 3:127763982-127764004 GCGCCTGAGAGCCGGGAGGGAGG - Intronic
961810338 3:129518430-129518452 GCACCTGGGAGCTGCAAGGAAGG - Intronic
963941541 3:151100560-151100582 TCTCCTGAGTTCTGCGAGGAAGG + Intronic
964916589 3:161848596-161848618 GAGCCTTAGAGCTGGGAGAAGGG - Intergenic
968002933 3:195220074-195220096 GATGCTGGGAGCTGGGGGGAGGG + Intronic
968188344 3:196649279-196649301 GCACCTGGGATCTGGGAGAATGG - Intronic
968448738 4:665270-665292 GCTGCTGAGTTCTGGGAGCAAGG + Exonic
968582146 4:1400178-1400200 GGTCCTGAGCCCTAGGAGGAGGG + Intergenic
968705539 4:2075766-2075788 GCTCTGGGGAGCTGGGAGAAGGG + Intronic
969063933 4:4462171-4462193 CTGCCAGAGAGCTGGGAGGAGGG - Intronic
969173302 4:5380945-5380967 GGGCCAGAGAGTTGGGAGGACGG - Intronic
969309552 4:6345568-6345590 GCCGCTGTGGGCTGGGAGGATGG + Intronic
969373202 4:6747120-6747142 ACTGCTGGGAGCAGGGAGGAGGG + Intergenic
969414840 4:7051422-7051444 GCTCCTGACAGGTGCGAGGCAGG + Intronic
969437868 4:7199093-7199115 TCTCCTGTGAGCCGGGAGGATGG + Intronic
970425409 4:15941119-15941141 GCCCCTCAGTGCTGGGAGCATGG - Intergenic
970515162 4:16821867-16821889 GAACGTGAGAGCTGGAAGGAAGG + Intronic
971321416 4:25608918-25608940 GCACCTGAGTTCTGGGAAGATGG - Intergenic
971384183 4:26127937-26127959 GCTCATGAAAGGTGGGAGCAGGG - Intergenic
973638017 4:52877705-52877727 ACTACTGTGAGCTGGGTGGAAGG - Intronic
973808106 4:54544973-54544995 GCTAGTGAGAGCTGAGAAGAGGG + Intergenic
977767272 4:100814083-100814105 GCTCCTGAGAGCAGGAAGCCAGG + Intronic
980120213 4:128720432-128720454 CCTCCTGATAGCTGGAGGGAAGG - Intergenic
980171241 4:129292487-129292509 GCTCTTTAGAGCTGGCAGGCAGG + Intergenic
980347062 4:131635179-131635201 GCTGTTGGGAGCTGGGAGGCTGG - Intergenic
981033774 4:140151310-140151332 CCCCCGGAGAACTGGGAGGAGGG + Intronic
982060224 4:151597576-151597598 TCTCTTGAGAGCTGGCAGGCAGG + Intronic
982163870 4:152597032-152597054 GTTACCGGGAGCTGGGAGGAGGG - Intergenic
982423287 4:155223455-155223477 CCTCCCGAGTGCTGGGAGTACGG + Intergenic
983167655 4:164497261-164497283 TCTCCTCAGAGCTGGCAGGCAGG + Intergenic
983278222 4:165644721-165644743 GCTGGTCAGAGCGGGGAGGATGG - Intergenic
984981883 4:185289964-185289986 CCTTCTGAGAGCGGTGAGGAAGG + Intronic
985898075 5:2762264-2762286 CCAGCTCAGAGCTGGGAGGATGG - Intergenic
986130887 5:4928969-4928991 GCTCCTGAGTACTGGGTGGGCGG - Intergenic
986207017 5:5634455-5634477 GGTCCTGAGAGCTGGGAAGGAGG - Intergenic
986332597 5:6728376-6728398 GCCTCTGAGAGCTGGCATGATGG + Intronic
987228810 5:15870903-15870925 TCTCTTCAGAGCTGGCAGGAAGG - Intronic
987241876 5:16008202-16008224 CCTCCTAAGAGCTGCCAGGAGGG - Intergenic
987476218 5:18394993-18395015 TCTCCTGAGACCTGGTAGGAAGG + Intergenic
990207078 5:53441276-53441298 GTTGCTGAGAGCTGGTGGGAGGG + Intergenic
990534213 5:56704163-56704185 GCTCCTGAGATGAGGGAGAAAGG - Intergenic
992107081 5:73458382-73458404 CCTTCTGAGGGCTGAGAGGAAGG + Intergenic
993735835 5:91476355-91476377 GGTCCAGAGAGGTGGGAGCAGGG - Intergenic
994091371 5:95812330-95812352 CCTCCTGAAAGCTGGGGGCAGGG + Intronic
994830638 5:104778060-104778082 GCTGATGAGAGCTGGGAGACAGG + Intergenic
995207914 5:109503766-109503788 GAACCTATGAGCTGGGAGGAGGG + Intergenic
995336171 5:111002211-111002233 ACCCTTGAGAGCTGGGATGAGGG + Intergenic
996828667 5:127714764-127714786 GCTGGTGAGAGCAGGGAGAATGG - Intergenic
996917068 5:128724628-128724650 GCTCCTGAGAATTGGGCAGAAGG - Intronic
997227539 5:132220424-132220446 GCTCCTCAGAGCTGGGGTGGTGG + Intronic
997845319 5:137280864-137280886 GCCTCTGAGCGCTGGGAGGAGGG - Intronic
1000007219 5:157198164-157198186 GGTCCTGGGGGCTGGGAGTAGGG - Intronic
1001929194 5:175660651-175660673 AGTTCTGAGAGCAGGGAGGAGGG + Intronic
1002308563 5:178298680-178298702 GCTTCTGAGAGCTGGGAGCCAGG - Intronic
1002326430 5:178411610-178411632 GTTCCCAGGAGCTGGGAGGAGGG + Intronic
1002590962 5:180291659-180291681 GCTGCTGACAGCCGGGCGGAAGG + Intronic
1003267170 6:4576012-4576034 GCTCTTGACAGCAGGGTGGAGGG - Intergenic
1003364389 6:5458362-5458384 GCTCCTCAGCCCTGGCAGGAAGG - Intronic
1003986716 6:11442939-11442961 GCTCCTGAGAGCAGCCAGGAGGG + Intergenic
1004137527 6:12982210-12982232 GCTGCAGAGAGCTGCCAGGAGGG - Intronic
1004203962 6:13574548-13574570 GGTACAGAGAGCTGGGAGGGAGG + Intronic
1004355841 6:14929362-14929384 GCTCCTGAAAGCTGAGAGCCTGG + Intergenic
1004470833 6:15927703-15927725 GTTCCTGAGAGCTTGGGGGCAGG + Intergenic
1004707796 6:18140841-18140863 GATCCTGGGAGCTGGGGTGAAGG + Intronic
1006359632 6:33579982-33580004 GCTGCTGAGATCTGGGAGGATGG + Intronic
1006640005 6:35484997-35485019 ACTGCTGGGGGCTGGGAGGATGG - Intronic
1007285575 6:40745060-40745082 GCTCCTGAGAGGTCAGAGGAAGG + Intergenic
1007761968 6:44138635-44138657 GCCTTTGAGAGCAGGGAGGAGGG - Intronic
1008619387 6:53257054-53257076 GCTGGTGAGACCTGGGAGGTAGG - Intergenic
1008656915 6:53624528-53624550 GCTACTGACAGTTGGGAGCAAGG - Intergenic
1012499633 6:99874633-99874655 GCCACTGAAAGCTGAGAGGAAGG + Intergenic
1012858380 6:104529177-104529199 GCTCCTCTGAGCAGAGAGGATGG - Intergenic
1014569095 6:122986783-122986805 TCTCTTCAGAGCTGGGAGGCAGG - Intergenic
1015500816 6:133931280-133931302 TCTCCTTAGAGCTGGCAGGCAGG - Intergenic
1015589657 6:134810796-134810818 CCTTCTGAGGGCTGTGAGGAAGG - Intergenic
1015844801 6:137509027-137509049 GCTGCTGAGAGCTCAGAGAAGGG + Intergenic
1016738560 6:147506862-147506884 GCTCCTGGGCGCTGGGATGCTGG - Intergenic
1017817504 6:158026517-158026539 GCTCCTGGGTCCAGGGAGGAGGG - Intronic
1017871747 6:158492700-158492722 GCTCCTGAGGAGTGGGAGGATGG - Intronic
1017881981 6:158568363-158568385 GCTCCTGAAGGCAGGAAGGACGG + Intronic
1018629506 6:165810006-165810028 CCTCCTGAGAGCCGGGAGGAAGG - Intronic
1018713359 6:166513538-166513560 GCTCCTGGTAGCCTGGAGGAAGG + Intronic
1018833250 6:167462557-167462579 GCTCCTGTGTGCTGGGAAGGTGG + Intergenic
1018994522 6:168701060-168701082 GGTCCAGGGAGCTGGCAGGAGGG - Intergenic
1020586811 7:10079226-10079248 TCTGCTGAGAGCTGAGATGATGG + Intergenic
1021536584 7:21712042-21712064 GTTGCCAAGAGCTGGGAGGAGGG - Intronic
1021891367 7:25188920-25188942 ACTCCTGGGTGCTGGGAGAAGGG + Intergenic
1022815063 7:33905462-33905484 GCGCCCGAGAGCTGGGGGGCGGG - Exonic
1022951907 7:35347230-35347252 GCTCCTGAGAGCAATGGGGATGG + Intergenic
1023167171 7:37354424-37354446 GCTGCTGAGAGGTGAGAGGAGGG + Intronic
1023421606 7:39985859-39985881 TCTCTTGAGAGCTGTGAAGAGGG + Intronic
1023728595 7:43168965-43168987 GCTTCTGAGAGCTTGGGTGAGGG + Intronic
1024162459 7:46690954-46690976 GCAGCTGAGAACTGGAAGGAAGG - Intronic
1024778157 7:52812611-52812633 GTTGCTTAGAGCTGGGAGTAGGG - Intergenic
1025288069 7:57685175-57685197 GCTCCCTAGAGTTGGCAGGATGG + Intergenic
1025689439 7:63746437-63746459 GCCCCTGAGAGGTAAGAGGAGGG - Intergenic
1025730162 7:64101357-64101379 GCTGCACAGAGCTGGGAGGAGGG + Intronic
1026617188 7:71915864-71915886 AATCCTGGGAGTTGGGAGGATGG - Intronic
1026846266 7:73700626-73700648 GCTCCTGAGAGAAGGGAGAGAGG + Intronic
1026872717 7:73863024-73863046 GGTGCTGAGACCAGGGAGGAGGG - Intronic
1027123542 7:75539322-75539344 GTTGCTGAGGGCTGGGAAGAAGG - Exonic
1027176995 7:75910744-75910766 TCTCTGGAGAACTGGGAGGAGGG - Intronic
1027513724 7:79115036-79115058 TCTCCTGAAAGCCAGGAGGAGGG + Intronic
1028506930 7:91581024-91581046 TCTCTTTCGAGCTGGGAGGAAGG + Intergenic
1029361102 7:100089131-100089153 GCTCCCGGGAGAAGGGAGGAGGG + Intronic
1029440471 7:100584365-100584387 GCTCCTGTGAGCTTGGGGGGGGG - Intronic
1030801389 7:113856863-113856885 TCTCTTCAGAGCTGGCAGGAAGG - Intergenic
1031522784 7:122786876-122786898 GATGCTTAGGGCTGGGAGGATGG - Intronic
1032032750 7:128498066-128498088 GCTTCTGAAACCTGGGGGGATGG + Exonic
1032069014 7:128792301-128792323 GGTCCTGAGAGCAGGGAGAAAGG - Exonic
1032549992 7:132776210-132776232 GAACCTGAGTGATGGGAGGAGGG - Intergenic
1033311334 7:140264143-140264165 CCTCCTGAGAGCCGGGGGTAAGG - Intergenic
1034495082 7:151415844-151415866 GCTGCCCAGAGCTTGGAGGAGGG + Intergenic
1035254859 7:157619777-157619799 CTTCCTGAGGGCTGGAAGGAGGG + Intronic
1035629678 8:1097889-1097911 TCTCCTGAGCGCAGGGAGGTGGG - Intergenic
1037069558 8:14626753-14626775 CCTTCTGAGGGCTGTGAGGAAGG - Intronic
1037805389 8:22055720-22055742 GCTCCAGAGAGAAGGGAGGAAGG - Intronic
1038539310 8:28378359-28378381 CCTCCTAAGAGCTGGGACCATGG + Intronic
1039500792 8:38015215-38015237 GCTGCAGTGAGCTGTGAGGATGG - Intergenic
1040459748 8:47635785-47635807 GCTTCTGACCTCTGGGAGGAAGG + Intronic
1041121455 8:54590494-54590516 GGTCCTGAGAGCTTTGAGGAGGG - Intergenic
1042423408 8:68618972-68618994 GTTACTGAGAGCTAGGGGGATGG + Intronic
1042656972 8:71110355-71110377 GAGGCTGAGAGATGGGAGGAGGG + Intergenic
1044267776 8:90203761-90203783 TCTCTTCAGAGCTGGGAGGCAGG - Intergenic
1045251609 8:100487425-100487447 CCTCTTGTGAGGTGGGAGGAGGG + Intergenic
1045344366 8:101281306-101281328 ACCCCTGGGAGGTGGGAGGAAGG - Intergenic
1045480932 8:102591527-102591549 GCTCCTGTCATCTGGAAGGACGG - Intergenic
1047784276 8:128138607-128138629 GCTTTTGGGAGTTGGGAGGAAGG - Intergenic
1047980351 8:130174597-130174619 CCTCCCCAGAGGTGGGAGGAGGG - Intronic
1048499181 8:134960318-134960340 CTTCCTGAGAGGTGGGAGAAAGG - Intergenic
1048845376 8:138600019-138600041 ACTCCTTAGAGCTGAGAGAAAGG - Intronic
1049215661 8:141406758-141406780 GCCCTTGAGAGCTGGCAAGATGG - Intronic
1049219902 8:141424424-141424446 GCGCCTCAGAGCAGGGAGGGTGG - Intronic
1049316630 8:141972609-141972631 GCTCCCTGGCGCTGGGAGGAAGG + Intergenic
1049345146 8:142134770-142134792 GAGCCCCAGAGCTGGGAGGAGGG - Intergenic
1049357074 8:142194183-142194205 GGAGCTCAGAGCTGGGAGGAGGG - Intergenic
1049414303 8:142488352-142488374 GATGCTGAGAACTGGGAGCAGGG - Exonic
1049469926 8:142770730-142770752 GCTCCTTATGGCTGGGAGGTGGG + Intronic
1049493446 8:142917021-142917043 GGAGCTGAGAGCTGGGAGCAGGG - Intronic
1049509563 8:143020678-143020700 CCTCCTGAAACCTGGCAGGAGGG - Intronic
1049786623 8:144454018-144454040 CCTCCTCAGAGCTGGGAGGCAGG + Intronic
1050545358 9:6704597-6704619 CCTCTAGAGAGCTGCGAGGATGG - Intergenic
1051272650 9:15370660-15370682 GCTCCCGAGAGTGAGGAGGAGGG - Intergenic
1052167556 9:25351797-25351819 GCTACTAAGAGGAGGGAGGAAGG - Intergenic
1052827503 9:33187745-33187767 GCTCCAGAGAGTTGGCTGGAGGG - Intergenic
1053416730 9:37951633-37951655 GCTCCTGAGCTCAGGGAGGGTGG - Intronic
1054879578 9:70130748-70130770 GCTCCTGAGGGATGGCAGGGAGG + Intronic
1055090318 9:72358364-72358386 GCTCCTGAGACAAGGGAAGAAGG + Intronic
1056122756 9:83505503-83505525 GCCTGAGAGAGCTGGGAGGAAGG + Intronic
1056378475 9:86036304-86036326 GCTCTGGAGAGCTGGGAACAGGG + Intronic
1057114533 9:92508011-92508033 GCTCCAGAGAGGGGGAAGGAGGG - Intronic
1057224937 9:93288116-93288138 GCATCTGAGAGGTGGCAGGACGG - Intronic
1057482326 9:95455089-95455111 CTTCCTTTGAGCTGGGAGGAGGG - Intronic
1057712852 9:97462883-97462905 GCTCCTGCCAGAAGGGAGGAAGG - Intronic
1057903872 9:98969589-98969611 GCTCCTGGTAGCTGGTAGGGAGG + Intronic
1059703796 9:116801245-116801267 GCTCCAGACAGCAGGGAGGATGG - Intronic
1060143544 9:121231606-121231628 TCAACTGAGAGCTGGGAAGAGGG + Intronic
1060275190 9:122177113-122177135 GCTCCTGGGAGCTCAGAGCAGGG + Intronic
1060429764 9:123540720-123540742 GCTGCTGACAGCAGGGAGTACGG + Intronic
1060553239 9:124495513-124495535 CCTCCTGAGACCTGGGAAGGAGG + Intronic
1060605740 9:124912362-124912384 GCTCCTGAAAGCTGAGGGGCTGG + Intronic
1061119246 9:128633132-128633154 CATCCTGAGACCTGGGAGGTCGG + Intronic
1061398091 9:130354363-130354385 CCTCCTGAGACCAGGGAGGGAGG + Intronic
1061431253 9:130532778-130532800 GTCCCTGAGGGCTGAGAGGAGGG + Intergenic
1061537263 9:131257924-131257946 GGGCCTGGGAGATGGGAGGAGGG - Intergenic
1061991891 9:134163679-134163701 GCTCCAGCGAGCAGGGCGGACGG - Intergenic
1187261173 X:17686582-17686604 GCTCATGACAGCTGGGAGAAGGG - Intronic
1187421113 X:19134515-19134537 GCTGCTGAGAGGTAGGAGGCAGG - Intergenic
1188212598 X:27442905-27442927 GCTACTGAGAGCAGGGGGAAAGG - Intergenic
1189330092 X:40139116-40139138 GGTGCTGGGGGCTGGGAGGAGGG + Intronic
1192182914 X:68927456-68927478 GCTAGTGAGTGCTGGGAGGAGGG + Intergenic
1192201258 X:69068101-69068123 GCTCCTGGAAGCTGGAAGCAGGG - Intergenic
1192301357 X:69906626-69906648 CCTCCTGAGAGCTAGGATGATGG + Intronic
1192495813 X:71616196-71616218 AGTCCTCAGAGCTGGGAGGGTGG + Exonic
1192958123 X:76095391-76095413 TCTCTTCAGAGCTGGCAGGAAGG + Intergenic
1193075237 X:77348079-77348101 TCTCCTCAGAGCTGGCAGGGAGG - Intergenic
1193081528 X:77411586-77411608 ACTCCTCAGAGCTGGCAGGCTGG + Intergenic
1196941506 X:120780954-120780976 TTTCCTAAGAGCTGGGATGAAGG - Intergenic
1197892515 X:131280791-131280813 GCTCCTGAGAGCTAGGGATAAGG + Intronic
1198710056 X:139491648-139491670 CCTCCTAAGGGCTGTGAGGAAGG + Intergenic
1199004073 X:142674924-142674946 TCTCTTCAGAGCTGGGAGGCAGG + Intergenic
1199143011 X:144334143-144334165 TCTGCTGACAGCTGGGAGAAAGG - Intergenic
1199746982 X:150778029-150778051 GCTGGTGAGAGTTGGGAGGGAGG + Intronic
1200062198 X:153488652-153488674 GGTCGTGAGAGCTGGGAGAGTGG - Intronic
1200218493 X:154379216-154379238 TGCCCTGAGAGCTGGGAGGCTGG - Exonic
1202232102 Y:22668777-22668799 CCTCCTGTGAGCTTGGAGGCTGG + Intergenic
1202311054 Y:23527381-23527403 CCTCCTGTGAGCTTGGAGGCTGG - Intergenic
1202559748 Y:26143213-26143235 CCTCCTGTGAGCTTGGAGGCTGG + Intergenic