ID: 1069898212

View in Genome Browser
Species Human (GRCh38)
Location 10:71691969-71691991
Sequence AGCTCCTGAGAGCTGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 1, 1: 0, 2: 5, 3: 56, 4: 495}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069898212_1069898222 7 Left 1069898212 10:71691969-71691991 CCTCCTCCCAGCTCTCAGGAGCT 0: 1
1: 0
2: 5
3: 56
4: 495
Right 1069898222 10:71691999-71692021 CAGTGAGCCCTCATTCCCAGGGG No data
1069898212_1069898227 30 Left 1069898212 10:71691969-71691991 CCTCCTCCCAGCTCTCAGGAGCT 0: 1
1: 0
2: 5
3: 56
4: 495
Right 1069898227 10:71692022-71692044 TCTCAGAGTCATGTCATGAATGG No data
1069898212_1069898221 6 Left 1069898212 10:71691969-71691991 CCTCCTCCCAGCTCTCAGGAGCT 0: 1
1: 0
2: 5
3: 56
4: 495
Right 1069898221 10:71691998-71692020 ACAGTGAGCCCTCATTCCCAGGG No data
1069898212_1069898220 5 Left 1069898212 10:71691969-71691991 CCTCCTCCCAGCTCTCAGGAGCT 0: 1
1: 0
2: 5
3: 56
4: 495
Right 1069898220 10:71691997-71692019 CACAGTGAGCCCTCATTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069898212 Original CRISPR AGCTCCTGAGAGCTGGGAGG AGG (reversed) Intronic
900156384 1:1204907-1204929 GGCACATGAGAGCTGGGAGAAGG - Intronic
900189303 1:1346516-1346538 AGATCCCCAGGGCTGGGAGGAGG - Intronic
900243544 1:1627696-1627718 TGCTCCTGAGTGCTGGGTGCCGG + Exonic
900373311 1:2342037-2342059 CACTCCTGAGAGCTGGGGAGGGG - Intronic
900671703 1:3858383-3858405 AGCTCCTGGCAGCAGGGAGGCGG + Intronic
900726354 1:4218802-4218824 AGCCCCAGAAAGCTGAGAGGAGG - Intergenic
900743848 1:4346800-4346822 AGCTCCCAACAGCTGGGAGCTGG + Intergenic
900900087 1:5510143-5510165 AGCCCCAGAGAGCTGGAAGGAGG + Intergenic
900935873 1:5766171-5766193 ACCTCCTGGGAGCTGGCAGTAGG - Intergenic
901023512 1:6267168-6267190 GGCTCCTGTGGGCTGGGTGGGGG - Intronic
901198357 1:7453022-7453044 AGGTCCTGGGGGCTGGGATGGGG - Intronic
901635022 1:10666499-10666521 AGCTCCTGGGGGCTGGGAAGTGG - Intronic
902235522 1:15054914-15054936 GGCTCCTGAGAGCTGGGCTTAGG + Intronic
902599197 1:17529671-17529693 AGTTCCTGGGAGCTCAGAGGAGG + Intergenic
902783747 1:18720218-18720240 AGCATCTGAGAGCTGGGAGGAGG - Intronic
903188445 1:21642599-21642621 AGCTCCTTGGAGCAGGGAGGAGG + Intronic
903539791 1:24090427-24090449 GGCTCCCGAGGGCTGAGAGGAGG + Intronic
903575720 1:24338453-24338475 AGCTTTTGGGAGCTGGGCGGGGG + Intronic
904393341 1:30199891-30199913 GGCTCCTGAGAGGTGGGAAGGGG - Intergenic
905351058 1:37346716-37346738 AGTTCCTGAGTGCAGGGAGATGG + Intergenic
905389376 1:37626433-37626455 AGCCCCGGGGAGTTGGGAGGAGG - Intronic
906526113 1:46494197-46494219 AGCTTTTGAGAGCAGGTAGGTGG - Intergenic
906552062 1:46673271-46673293 ACCTCCTGAAAGATGGGAAGTGG - Exonic
906920919 1:50063636-50063658 AGCACCTGAGATCTGGAAGCAGG - Intronic
907614583 1:55911300-55911322 TGCTCCTCAGAGATGGGAGGGGG - Intergenic
910659375 1:89654780-89654802 AGATCCTAAAAGCTTGGAGGAGG - Intronic
911280066 1:95913711-95913733 AGCTCATGAGATCTGCGTGGTGG + Intergenic
912163921 1:107019771-107019793 AGCGGCTCAGAGATGGGAGGTGG + Intergenic
912396639 1:109350062-109350084 ACAGCCTGAGAGCTGGAAGGAGG - Intronic
912641066 1:111346561-111346583 AGCTGCGGAGCGCGGGGAGGGGG - Exonic
912722036 1:112028476-112028498 GGCTCCTAAGAGGTGGCAGGAGG + Intergenic
915489923 1:156245227-156245249 AGCTCCAGGAAACTGGGAGGCGG + Exonic
915722924 1:157996979-157997001 CGCTCCAGTGAGATGGGAGGAGG + Intronic
915978895 1:160408145-160408167 ACCTTCTGGGAGCTGGGATGGGG + Intronic
916209334 1:162347266-162347288 AGCTTCTGAGAGTTAGGATGTGG - Intronic
916548640 1:165828917-165828939 GGATCCTGAGAGCTGGGTGCTGG + Intronic
917522207 1:175757537-175757559 ATGTCCTGAGAGTGGGGAGGCGG + Intergenic
921267208 1:213431141-213431163 TGCTCCTGAGAGATGACAGGTGG + Intergenic
921855378 1:219976395-219976417 AGCTCCTGAAAGCTGAATGGGGG + Intronic
922096177 1:222444927-222444949 AGCTGGAGAGAGCTGGGAAGGGG - Intergenic
922460482 1:225811248-225811270 GGCTCCCGAGATCTTGGAGGTGG + Intronic
922792497 1:228317926-228317948 AGCCCCTGAGAGCCGGCAGGTGG + Exonic
922996146 1:229963168-229963190 AGCACCTGAGAGCAGGGTGCTGG + Intergenic
923156466 1:231283635-231283657 AGCTCCTGGGAGTTGGGAAATGG + Intergenic
923377474 1:233379058-233379080 AGAAGCTGAAAGCTGGGAGGAGG + Exonic
924554611 1:245107894-245107916 AGCTTCTGAGAGCGGTGACGAGG - Intronic
1062840612 10:667239-667261 AGCTACTCAGGACTGGGAGGAGG + Intronic
1063193128 10:3716854-3716876 AGCTCCGGACAGCTGAGAGTTGG - Intergenic
1063196144 10:3745570-3745592 CACTTCTGAGAGATGGGAGGAGG - Intergenic
1063297763 10:4825091-4825113 AGCTCCTCACAGGTGGGAAGGGG - Intronic
1063368669 10:5507252-5507274 AGCTCCTGAGAGGCGGGGAGCGG - Intergenic
1064169543 10:13018119-13018141 AGCTCCAGAGGGCTGGGAGAGGG + Intronic
1064245934 10:13667589-13667611 AGCTGCTGAGGGATGGGGGGAGG + Intronic
1065231483 10:23603164-23603186 AGTTGCTGGGACCTGGGAGGTGG - Intergenic
1066080555 10:31927877-31927899 AGCTCCCCTGAGATGGGAGGCGG + Intronic
1066632426 10:37470064-37470086 AGCTCATGGAAGTTGGGAGGGGG + Intergenic
1067976042 10:51026146-51026168 TCCTTTTGAGAGCTGGGAGGAGG - Intronic
1068612006 10:59070378-59070400 AGTTCCTGAGAACTGGTTGGGGG + Intergenic
1068795287 10:61072599-61072621 AGTTGCTGAAACCTGGGAGGTGG + Intergenic
1069175696 10:65286128-65286150 AGCTCCTGAAAGCAGCCAGGAGG - Intergenic
1069719983 10:70543815-70543837 ACCTCCTGGGAGCTGGGAAAGGG - Intronic
1069898212 10:71691969-71691991 AGCTCCTGAGAGCTGGGAGGAGG - Intronic
1070335295 10:75449704-75449726 ACCTCATGAGGCCTGGGAGGTGG + Intronic
1071381139 10:85061356-85061378 AGTTCCCAAGAGCTCGGAGGTGG - Intergenic
1071600289 10:86955659-86955681 TGCTCCTGTGACCAGGGAGGTGG - Intronic
1072631173 10:97147616-97147638 AGGTTCAGAGAGCTGGGAGGGGG + Intronic
1072739908 10:97903124-97903146 TGCTCCTGAGAGCTCTGGGGAGG + Intronic
1074468385 10:113705004-113705026 AGCTCCTTAGAGAAGGGAGCTGG - Intronic
1075871507 10:125774864-125774886 ACGTCCTGAGAGCTGGGAATTGG + Intronic
1076341125 10:129745409-129745431 AGTTGCTGAGAGCTGGAATGGGG - Intronic
1076407463 10:130222170-130222192 AGCAGCTTAGAGATGGGAGGCGG + Intergenic
1076618111 10:131770373-131770395 AGCTCCTGAGGGCAAGGAGCTGG - Intergenic
1076672354 10:132130273-132130295 AGCTCTTGGGAGCTGGGTGATGG + Intronic
1077179166 11:1204506-1204528 TGCTGGGGAGAGCTGGGAGGGGG - Intergenic
1077265656 11:1648293-1648315 TGCTCCTGAAGGCGGGGAGGCGG + Intergenic
1077621172 11:3725484-3725506 AAGTGCTCAGAGCTGGGAGGAGG - Intronic
1079184230 11:18221673-18221695 TGCTCTTGAGGGCTGGGAGCAGG - Intronic
1079954759 11:26849166-26849188 AGCTCCTGAGAGCAGGGCTGGGG + Intergenic
1081847876 11:46253604-46253626 ATCTCCTGGGATCTGAGAGGGGG - Intergenic
1082831810 11:57623909-57623931 ATCACCTGAGTCCTGGGAGGTGG + Intergenic
1082968921 11:58998644-58998666 AGCTCCTGACAACTTAGAGGAGG - Intronic
1083141061 11:60722362-60722384 AGCTCCTAAGGGGTGGGATGTGG - Intergenic
1084569741 11:69952070-69952092 GTCTCCTGTCAGCTGGGAGGTGG + Intergenic
1084710390 11:70840457-70840479 TGCTCCTCAGAGCTGAGAGGGGG - Intronic
1085013436 11:73157252-73157274 AGCTCCTGACAGCAGTGAAGGGG - Intergenic
1085054632 11:73396344-73396366 AGCTCCTGAGATCTTGGGGCTGG - Exonic
1086402700 11:86473564-86473586 AGATCCTGAGAGCTAGGAGGAGG + Intronic
1088706032 11:112465527-112465549 AGCAGCTGAGAACAGGGAGGTGG + Intergenic
1089528222 11:119110543-119110565 AGCACCTGAGACCGGCGAGGTGG - Exonic
1089992737 11:122876828-122876850 ATCTCCTGAACCCTGGGAGGAGG - Intergenic
1090387499 11:126365330-126365352 GGTTCCTCAGGGCTGGGAGGAGG + Intronic
1090390065 11:126382528-126382550 GGTTCCTCAGGGCTGGGAGGAGG + Intronic
1090621410 11:128564182-128564204 AACTCCGGAGAGCTGGGGAGTGG - Intronic
1091601225 12:1918709-1918731 CTCTCCTGACAGCAGGGAGGGGG + Exonic
1093608003 12:21118050-21118072 AGCTGCTTGGAGCTGGGAGATGG + Intronic
1094350078 12:29514926-29514948 ATCTCTTGAGCCCTGGGAGGTGG + Intronic
1096111664 12:49032433-49032455 AGCTGCAGAGAGCTGGGCTGAGG + Exonic
1096382706 12:51172642-51172664 CGTTCCTGAGAGCTGGGCAGGGG - Exonic
1096498894 12:52053898-52053920 TGCTCCTGGGAGCTGGGCTGAGG + Intronic
1096514204 12:52147346-52147368 AGCTCCTGAGCCCTGGGCTGGGG + Intergenic
1096518372 12:52170672-52170694 AGCTGCTGGGAGCTGGCTGGGGG + Exonic
1096869838 12:54586397-54586419 TGCTCCTGAGAGCTAGGATTTGG - Intronic
1097730753 12:63125542-63125564 AGCAACTTAGAGATGGGAGGTGG - Intergenic
1099686405 12:85894886-85894908 AGCTAATGAGAACTGGGAGATGG + Intergenic
1101289361 12:103352023-103352045 GGCTCCTGGGAGCTTGGAGCAGG - Intronic
1101558649 12:105834568-105834590 GGCTTCTGAGAGTTGGGAGTGGG - Intergenic
1101901186 12:108792376-108792398 AGGGCCTGGGAGCAGGGAGGTGG - Exonic
1101979648 12:109394846-109394868 ATCACCTGAGCTCTGGGAGGTGG - Intronic
1103324983 12:120114569-120114591 AGATCCTCAAAGCTGGGAGATGG - Intronic
1103447755 12:121005353-121005375 AGCACCTGGCACCTGGGAGGAGG - Intronic
1103996951 12:124836376-124836398 GCTTCCTGAGAGATGGGAGGTGG - Intronic
1104729011 12:131094866-131094888 GGCTGCTGAGAGCTGGGCTGGGG + Intronic
1104980387 12:132570836-132570858 GGGTCCTGAGCCCTGGGAGGAGG + Intronic
1106652990 13:31711823-31711845 ATCTCATGAGAGATGGGAGAAGG - Intergenic
1107866832 13:44711191-44711213 AGCCCCTGAGAGGTGGGAGCTGG + Intergenic
1108292702 13:48976569-48976591 AGCTCCGGAGGGCTCGGGGGCGG + Intronic
1108453936 13:50594811-50594833 AGCTCCAGGGAGCAGGGAGATGG - Intronic
1108530241 13:51321405-51321427 AGCTCCTGCCAGCAGGGAAGAGG - Intergenic
1108574263 13:51778057-51778079 AGCTCCTGCGAGCTGGATGCAGG - Intronic
1110769062 13:79315977-79315999 AGTTCCTGAGATCTGGGAAAAGG + Intronic
1111051001 13:82883214-82883236 AGGTCATGAGATTTGGGAGGGGG + Intergenic
1111840404 13:93442499-93442521 AGTTTCTGGGAGATGGGAGGTGG - Intronic
1112000367 13:95204055-95204077 GGCTCCTGAGACCTGGCCGGAGG + Intronic
1112143428 13:96671597-96671619 TCCTTCTGAGGGCTGGGAGGAGG + Intronic
1112309217 13:98302911-98302933 AGCTCCTGAGCTGAGGGAGGAGG + Intronic
1112820021 13:103322024-103322046 AGCTTCAAATAGCTGGGAGGAGG + Intergenic
1112907902 13:104446737-104446759 AGTGCCTGAGATCTGGGCGGGGG - Intergenic
1113318817 13:109212688-109212710 TGCTCCTGACAGTTGGTAGGTGG + Intergenic
1113389808 13:109884787-109884809 AGCCTCTGAGACCTGGGAGGTGG - Intergenic
1113437139 13:110302000-110302022 AGAGCACGAGAGCTGGGAGGAGG + Intronic
1114281083 14:21192797-21192819 CTCTACTGAGAGCTGGGAAGAGG + Intergenic
1116221787 14:42096574-42096596 TGCTCCTGGGGGCTGGGAGCAGG - Intergenic
1118509284 14:66452991-66453013 ATCTTCTGAGAAGTGGGAGGAGG - Intergenic
1120697835 14:87664433-87664455 AGAACCTGACAGCTGGTAGGTGG - Intergenic
1121175708 14:91889316-91889338 AGCAGCTGAGAGCGGTGAGGGGG - Intronic
1121573806 14:94967142-94967164 AGCTCCTGTGGGCTGGGAGAAGG - Intergenic
1122042270 14:98997274-98997296 AGCTCCTGAGAGCTGGTTTAAGG + Intergenic
1122367601 14:101203380-101203402 AGCTCAGGGGAGCTTGGAGGAGG - Intergenic
1122488341 14:102096290-102096312 AGCTGCTGTGAGCTCGGAGGAGG - Intronic
1122626441 14:103087650-103087672 AGCTCCTCTGAGCCTGGAGGAGG + Intergenic
1122681654 14:103469266-103469288 AACTGCTGGGACCTGGGAGGTGG - Intronic
1122718121 14:103707355-103707377 AGGTGCTGAGGGCAGGGAGGGGG + Intronic
1122905046 14:104797746-104797768 GGCCCCTGAGCTCTGGGAGGAGG - Intergenic
1122941656 14:104984248-104984270 AGGCCCAGGGAGCTGGGAGGGGG - Intergenic
1123578767 15:21697531-21697553 AAGTCCTGAAAGCTGGGATGAGG + Intergenic
1123615394 15:22140013-22140035 AAGTCCTGAAAGCTGGGATGAGG + Intergenic
1123758270 15:23413892-23413914 CGCTCCCCAGAGCTGGGAGAAGG + Intergenic
1123983460 15:25623826-25623848 AGCTTTTCAGAGCTGGGTGGAGG - Intergenic
1124103470 15:26716813-26716835 AGGTCCTCAGAGCTGGGCTGTGG - Intronic
1124103478 15:26716844-26716866 AGGTCCTCAGAGCTGGGCTGTGG - Intronic
1124103486 15:26716875-26716897 AGGTCCTCAGAGCTGGGCTGTGG - Intronic
1124103503 15:26716937-26716959 AGGTCCTCAGAGCTGGGCTGTGG - Intronic
1125137697 15:36363194-36363216 AGCTCCTGAGAGGAGCAAGGAGG + Intergenic
1125500621 15:40238569-40238591 CGCTCCGGGGAGCTGGCAGGGGG + Intergenic
1125542818 15:40480369-40480391 GTCTCCTGAGGGCAGGGAGGAGG - Intergenic
1125781682 15:42274440-42274462 TTGTCCTGAGAGCTGGGAGCTGG + Exonic
1126851153 15:52798089-52798111 AGCCACGGAGAGCTGGGGGGCGG + Intergenic
1127349499 15:58136310-58136332 AGATCCTCCGAGCTGTGAGGTGG - Intronic
1127545930 15:59994376-59994398 AGCTCCCCAGAGCTGAGGGGTGG + Intergenic
1127707236 15:61559399-61559421 TGCTCCTGAGAACTGGCAGCTGG - Intergenic
1128065377 15:64761302-64761324 TGCTACTGAGGGCTGGGAGTTGG - Intronic
1128451351 15:67807503-67807525 ATTTCCTGAGAGGTGAGAGGTGG - Intergenic
1128570128 15:68727686-68727708 AGCTCCAGAAATGTGGGAGGAGG - Exonic
1128770072 15:70275484-70275506 AGTACCACAGAGCTGGGAGGTGG + Intergenic
1128987190 15:72230382-72230404 GCCTGCTGGGAGCTGGGAGGCGG + Intronic
1129160068 15:73742452-73742474 AGGTGCTCAGAGATGGGAGGTGG - Intronic
1129170668 15:73805624-73805646 AGGTCATGAGAGCAGGGAGAGGG + Intergenic
1129513318 15:76140579-76140601 AGCTCAAGAGCACTGGGAGGCGG - Intronic
1130577561 15:85105909-85105931 AGCTTCTGAGAGCTGGGTGCTGG + Intronic
1130772034 15:86934163-86934185 AGCTGCTGTGAGCTGGGGAGAGG + Intronic
1130863208 15:87909262-87909284 GGCTCCTGAGAAGTGAGAGGAGG + Intronic
1131230415 15:90654880-90654902 AGCTCCTCAGAGCTGGGCCAGGG - Intergenic
1131266570 15:90918903-90918925 AGCTCCGGAGGCCTGGCAGGGGG + Intronic
1131450824 15:92538338-92538360 AGCCCCTGACAGCTGGGAGCTGG - Intergenic
1202987637 15_KI270727v1_random:431776-431798 AAGTCCTGAAAGCTGGGATGAGG + Intergenic
1132835462 16:1950774-1950796 AGCTCCTGGAAGCTGGGGTGAGG + Intronic
1133341572 16:5039891-5039913 AGCCACTGAGAGATGGGAGTGGG + Intronic
1133443283 16:5838268-5838290 AGCTCCTGAGGTATGGGTGGCGG + Intergenic
1133770910 16:8866932-8866954 AGCCCCTGAGTGCTGGGAAGAGG + Intronic
1134016029 16:10889089-10889111 ACATGCTGAGAGCTGGGAGAAGG + Intronic
1134458068 16:14409002-14409024 TGCTCCCCAGAGCTGGGAGAAGG - Intergenic
1135735836 16:24931205-24931227 GGGTGCTGAGAGCTGGGAGGGGG + Exonic
1135779018 16:25282679-25282701 GGCTCCTGGAAGCTGAGAGGGGG - Intergenic
1137400941 16:48154043-48154065 AGCTGATGAGAGCTGGGAGGAGG + Intronic
1137502732 16:49023974-49023996 AGCTCCTGGGAGCTGGCAGGAGG + Intergenic
1137934982 16:52626154-52626176 GGCTCAAGAGAGGTGGGAGGAGG - Intergenic
1138226001 16:55295178-55295200 AGTTCCTGAGACCTGGGGTGTGG - Intergenic
1138504387 16:57470441-57470463 AGCTTATGAGAACTGCGAGGTGG - Intronic
1138526212 16:57608851-57608873 AGCTAATGAGAGCAGGAAGGGGG - Intergenic
1138628193 16:58269497-58269519 GGCTGCTGAGAGCTGGAGGGTGG - Intronic
1139335284 16:66226903-66226925 GGCTTCTGAGAGCTGTAAGGCGG - Intergenic
1139548923 16:67662804-67662826 AGCTGGTGAGACCAGGGAGGAGG - Intergenic
1139651250 16:68363327-68363349 AGCTTTTGAGAGCTGGGAGCTGG - Intronic
1140575753 16:76166490-76166512 AGCTCCTGATACCAGGGAGTAGG - Intergenic
1141203647 16:81915788-81915810 AGCTCCTCAGGGCAGGCAGGGGG - Intronic
1141706189 16:85666115-85666137 AGCTCCTGCCAGCGGGGAGAAGG + Exonic
1141811541 16:86379356-86379378 AGGCCAGGAGAGCTGGGAGGAGG + Intergenic
1142003058 16:87675151-87675173 AGCTTCTGCCAGCTGGGGGGTGG - Intronic
1142147230 16:88497691-88497713 AGCTGCTGTGAGGCGGGAGGAGG + Intronic
1142351429 16:89582575-89582597 GGGTCCTGGGTGCTGGGAGGGGG - Intronic
1142409527 16:89908721-89908743 AGGAGCTGGGAGCTGGGAGGCGG - Intronic
1142484258 17:236536-236558 AGGTCCTGAGAGCGGGGTGGGGG + Intronic
1142509943 17:386739-386761 AGCTCCTGGGGGCTGGGGGGTGG - Intergenic
1142903433 17:3027174-3027196 AGGGCCTCACAGCTGGGAGGAGG - Intronic
1143031040 17:3967226-3967248 GGTTCCTGGCAGCTGGGAGGTGG - Intergenic
1143152606 17:4816768-4816790 AGCCCCAGAGAGCTGAGAGCAGG + Intronic
1143316345 17:6036192-6036214 ACCTGGTGAGAGCCGGGAGGCGG - Intronic
1144068671 17:11647015-11647037 GGCACCGGTGAGCTGGGAGGGGG + Intronic
1144201079 17:12943334-12943356 AGCTCTTCAGAGCTGGAACGTGG - Intronic
1144265971 17:13569921-13569943 AGCTTCTGTGAGCAGGAAGGTGG - Intronic
1144662685 17:17081525-17081547 AGCTCCAGATAACTGGGATGGGG + Intronic
1145399175 17:22517344-22517366 GCCTCCGGAGGGCTGGGAGGGGG - Intergenic
1145830690 17:27913854-27913876 GGCTGCTGAGAGGTGGGAGTGGG - Intergenic
1146013147 17:29211893-29211915 AGGTCCTGAGTGCTGGCAGTGGG - Intergenic
1146666263 17:34706228-34706250 AGCTCCTGACAGCCGGGAGAAGG + Intergenic
1147267643 17:39244493-39244515 AGAGCCAGAGAGCTGAGAGGTGG - Intergenic
1147560424 17:41505474-41505496 GGCTCTTGCCAGCTGGGAGGAGG - Exonic
1147649716 17:42055006-42055028 AGCACCTGGTGGCTGGGAGGGGG + Intronic
1147949896 17:44101453-44101475 AGCCCCAGAAAGCTAGGAGGAGG + Intronic
1147966592 17:44197482-44197504 AGCTCCTGTGAGCCGGGGGAGGG - Intronic
1148216382 17:45835970-45835992 AGCCCCTGAGGGCCGGGAGAGGG + Intergenic
1148240710 17:45997959-45997981 AGCTCCCCAGTGCTGGGTGGCGG - Intronic
1148431848 17:47649608-47649630 ACCGGCTGAGCGCTGGGAGGAGG - Intronic
1148739489 17:49884498-49884520 CTGTCCTGAGAGCTGGGATGGGG + Intergenic
1149682506 17:58515939-58515961 AACTCCTAAGAGCTAGGAGGAGG - Intronic
1150337990 17:64343984-64344006 AGCTCCTGAAAGCTGGGACCAGG - Intronic
1150479594 17:65499185-65499207 CCCTCCTGAGGGTTGGGAGGAGG - Intergenic
1151417132 17:73973864-73973886 AGCTCCAGAGGCCTGGGGGGGGG - Intergenic
1152016888 17:77756696-77756718 CGCTCCTGAGAGATGGATGGAGG - Intergenic
1152158041 17:78647758-78647780 GGCTCCGGAGGGCAGGGAGGGGG + Intergenic
1152461082 17:80442839-80442861 AGCATCACAGAGCTGGGAGGAGG + Intergenic
1152461122 17:80443125-80443147 AGCATCACAGAGCTGGGAGGAGG + Intergenic
1152464264 17:80456937-80456959 AGCTGCAGAGAGCTGGACGGGGG - Intergenic
1152561506 17:81081123-81081145 GGGGCCCGAGAGCTGGGAGGTGG + Intronic
1152694800 17:81738745-81738767 AGCTCCTGGGAGCTTGGGGCAGG - Intergenic
1152786221 17:82249400-82249422 AGCCCCAGAGCGCTGGGAGGGGG + Intronic
1152930895 17:83109419-83109441 AGCTCCTGGGATGTGGGAGAGGG - Intergenic
1152936992 17:83144900-83144922 AGCTTCTGTGAGCACGGAGGAGG + Intergenic
1153200145 18:2639333-2639355 ATCTCCTGAGCTCAGGGAGGTGG + Intergenic
1153659982 18:7317748-7317770 ATCTCCTGGGAGCTGGGGGTCGG - Intergenic
1154157051 18:11951910-11951932 AGAACCTGGAAGCTGGGAGGAGG - Intergenic
1154980041 18:21496286-21496308 AGGTCATAACAGCTGGGAGGTGG + Intronic
1155250971 18:23953064-23953086 GGCTCTTGAGTGCTGGCAGGTGG - Exonic
1155704621 18:28793522-28793544 AGCCCCTGAGAGGTGGGCAGGGG - Intergenic
1156249986 18:35343891-35343913 CGGTCCTGAGTGCTGGGAAGAGG - Intronic
1156465718 18:37346955-37346977 AGCCTCTGAGAACAGGGAGGAGG + Intronic
1157333780 18:46722319-46722341 ATCTCCTGACATCTGTGAGGTGG - Intronic
1157411265 18:47465320-47465342 AGCTCCTGGAAGGTGGGATGGGG - Intergenic
1157520506 18:48342150-48342172 TGCTCCTGGGCACTGGGAGGGGG - Intronic
1157589717 18:48829057-48829079 AGCTGCTGAAGGCTTGGAGGAGG + Intronic
1157869276 18:51214937-51214959 AGATCCTGAGCTCAGGGAGGCGG + Intronic
1158362656 18:56692976-56692998 AGATCCTTTGAGCTGGGAGGTGG + Intronic
1158889293 18:61858404-61858426 AGGTCCAGAGAGCTTGGGGGAGG - Intronic
1159129312 18:64261681-64261703 AGCTCCTCAAACCTGGGAGATGG + Intergenic
1159931349 18:74315804-74315826 GGCTCCCGAGGGCTGTGAGGAGG + Exonic
1160134018 18:76256142-76256164 AGGCCCTGGGAGCAGGGAGGGGG + Intergenic
1160534367 18:79584380-79584402 AGCCCCTGAGACCTGAGAGTGGG - Intergenic
1160989213 19:1853777-1853799 TGCTTCTGAGACCTGGGATGGGG - Exonic
1161447238 19:4325358-4325380 AGCTGCTGAGAGCTGGGGGTTGG - Intronic
1161571529 19:5033256-5033278 GGCTCCAGGGAGCTGGCAGGGGG + Intronic
1162561809 19:11421632-11421654 AGCTCCAGAGATCTAGGAGTAGG - Intronic
1162742921 19:12783385-12783407 ACTTCCTGTGGGCTGGGAGGAGG - Intronic
1163515534 19:17760971-17760993 AGCTCCTAAAAGCTCAGAGGGGG + Intronic
1165359731 19:35328909-35328931 ATTTCCTGAGAGCTGGGTAGAGG + Intronic
1166141597 19:40808151-40808173 AGGTATGGAGAGCTGGGAGGAGG + Exonic
1166377664 19:42336734-42336756 GGCTCCTAAGAGCCTGGAGGAGG + Intronic
1166519071 19:43467550-43467572 AGCCCCTAACAGCTGGGAGTTGG + Intergenic
1166775344 19:45308630-45308652 AGGGCCTGAGGGGTGGGAGGTGG + Intronic
1167037919 19:47005207-47005229 AGCAGGTGAGAGCCGGGAGGGGG - Intergenic
1167208198 19:48116571-48116593 GGCTCCTGAGAGTTGGGAGCTGG - Intronic
1167576700 19:50321092-50321114 AGGTGTTGAGAGCTGGGATGTGG + Intronic
1167648835 19:50719121-50719143 GGCCCCGGAGAGCCGGGAGGCGG + Intronic
1167650107 19:50724305-50724327 GGCTCCTGAGGGCGGGGTGGCGG - Intronic
1168524307 19:57076551-57076573 AGATTCTGAAAGCTGGGAGTAGG - Intergenic
925013207 2:501676-501698 AGCCTCTGAGGGCAGGGAGGAGG - Intergenic
925851174 2:8083649-8083671 AGCTTCTGAAAGCAAGGAGGTGG - Intergenic
925918237 2:8622608-8622630 AGATGCTGAGAGCTGGCAGGAGG - Intergenic
925970151 2:9100837-9100859 AGCTCCTGCGCGGTGGGAGGTGG + Intergenic
926142654 2:10377581-10377603 GGCTGCCGAGAGCTGGCAGGGGG - Intronic
926246970 2:11129017-11129039 ATCTCCTGAGCCCAGGGAGGTGG + Intergenic
927022164 2:19028795-19028817 AGCTCCTGAGGGCTGGGCAGAGG + Intergenic
927214080 2:20656679-20656701 GGCTCCTGAGCTCTGGGTGGTGG + Intergenic
927875873 2:26654892-26654914 GGCTCATGGGAGCGGGGAGGTGG + Intergenic
928084421 2:28336959-28336981 ATCTCCTGGGAGCTGGCAGCTGG + Intronic
928225307 2:29443364-29443386 AGCAGCTTAGAGATGGGAGGCGG + Intronic
929230098 2:39550285-39550307 AGCGCTTGAGCCCTGGGAGGTGG + Intergenic
929578853 2:43069258-43069280 GGCTGGTGAGAGCTGGGTGGCGG - Intergenic
929928131 2:46231906-46231928 ATCAACTGAGAGCTAGGAGGTGG + Intergenic
930724823 2:54672808-54672830 TGATCCAGAGAACTGGGAGGCGG - Intergenic
931648038 2:64443155-64443177 AGTTGCTGAGAGCTAGGGGGAGG - Intergenic
932457377 2:71858186-71858208 AGCGCCTGGAAGGTGGGAGGTGG - Intergenic
932485202 2:72080504-72080526 TGCTCTTGGGAGCTGGGAGTAGG + Intergenic
933352659 2:81175186-81175208 ATCTCTTGACAGCTGGGAGCTGG + Intergenic
933695410 2:85213769-85213791 CACTCCTGGGTGCTGGGAGGAGG - Intronic
934563256 2:95323906-95323928 AGCTCCTGAGGGCAGGGGAGGGG + Intronic
934942295 2:98511482-98511504 AGGTATAGAGAGCTGGGAGGTGG + Intronic
935663358 2:105488611-105488633 AGGTGCTGACAGCTGAGAGGAGG - Intergenic
935726874 2:106031137-106031159 AGTTCATGAGAGATGGAAGGTGG + Intergenic
936119851 2:109731932-109731954 ATCACCTGAGCCCTGGGAGGTGG - Intergenic
936404947 2:112194601-112194623 AGCCACTGAGTCCTGGGAGGTGG + Intergenic
936966174 2:118129526-118129548 GGGTCCTGGGAGGTGGGAGGGGG - Intergenic
937128143 2:119487606-119487628 ACCCCCTCAGAGCTGGCAGGTGG - Intronic
937828075 2:126389404-126389426 AGGTCTTGAGATTTGGGAGGAGG + Intergenic
941641564 2:167994605-167994627 GGTTGCTGGGAGCTGGGAGGAGG - Intronic
942192318 2:173482415-173482437 AGCACCTGAAGGCTGGGAGAGGG - Intergenic
942862907 2:180636821-180636843 AGCTGCTTGGAGCTGGGAGTTGG - Intergenic
944057140 2:195534482-195534504 AGCTCCAGAGAGATGGGATAGGG - Intergenic
944336626 2:198542108-198542130 AGGTCCTGTGAGGTGGGAGTAGG + Intronic
944647655 2:201795643-201795665 AGGGGCTGGGAGCTGGGAGGAGG + Intronic
945088680 2:206159179-206159201 AGCCCCTGAGAGCCGGCAGATGG - Exonic
948632527 2:239311228-239311250 GGCTGCTGAGAGCTCGGAAGGGG - Intronic
948777498 2:240297265-240297287 TGCTCCTGTGAGCCTGGAGGAGG - Intergenic
1171147781 20:22800797-22800819 AGTTCCTGAGGGCAGAGAGGGGG + Intergenic
1171381586 20:24737892-24737914 TCAGCCTGAGAGCTGGGAGGAGG + Intergenic
1171387131 20:24778121-24778143 ATCTCCTGGGAGCTGGGGTGTGG - Intergenic
1172120137 20:32593540-32593562 AGGTCCAGAGAGCTGGTAGAGGG - Intronic
1172130154 20:32650081-32650103 GGTCCCTGAGTGCTGGGAGGAGG - Intergenic
1172773228 20:37393381-37393403 AGCTGGTGAGACCTGGGTGGAGG - Intronic
1172884077 20:38219764-38219786 GGCTCCTGGGAGGTGGGCGGAGG + Exonic
1173792608 20:45837605-45837627 AGGTTCTCAGACCTGGGAGGCGG + Intronic
1173876377 20:46374797-46374819 AGCTCTTGAGTGCTGGACGGTGG + Intronic
1174199472 20:48797403-48797425 AGCTCCTGAGAGGAGGGGGCTGG - Intronic
1175218579 20:57404450-57404472 AGGTTCTGAGAGCTGGGTCGGGG + Intronic
1175221330 20:57418414-57418436 AGATCCTCAGAGCTGGGGGTGGG - Intergenic
1175447182 20:59031297-59031319 TCCTGCTGATAGCTGGGAGGAGG + Intronic
1176107059 20:63394425-63394447 AGCTCCTGGGCTGTGGGAGGAGG + Intergenic
1176389993 21:6158470-6158492 AGCTCCTGGGTGGTGGGAGCAGG - Intergenic
1176415955 21:6474929-6474951 AGCTCCCGAGACCGGGGAGGCGG + Intergenic
1176423850 21:6535737-6535759 AGAACCTCAGAGCTGGGAGGAGG - Intergenic
1177275874 21:18912762-18912784 AGCTGCTTAGAGCTGTGAGTGGG + Intergenic
1177357918 21:20032138-20032160 TGCTCTTGGGAGCTGGGAGCAGG - Intergenic
1178624571 21:34204145-34204167 TGTTCCTGACAGCTGGGGGGGGG + Intergenic
1179523629 21:41961470-41961492 AGCTACTCAGAGCAGGGAGCTGG + Intergenic
1179691455 21:43083263-43083285 AGCTCCCGAGACCGGGGAGGCGG + Intergenic
1179699343 21:43144052-43144074 AGAACCTCAGAGCTGGGAGGAGG - Intergenic
1179926766 21:44539144-44539166 GGCTCCTGGGAGCAAGGAGGGGG + Exonic
1180148486 21:45935267-45935289 AGCTCATGAGTGCTGGCCGGTGG - Exonic
1181013941 22:20057552-20057574 AGCTCCCAAGAGCTGGGCAGTGG + Intronic
1181160008 22:20954323-20954345 ATGTACTGAGAGCTGGGAGTAGG - Intergenic
1182574911 22:31266522-31266544 TTCTGCTGAGAACTGGGAGGGGG + Intronic
1182766419 22:32761079-32761101 AGCCTCTGAGGGCTGGGAGGTGG + Intronic
1183062943 22:35346778-35346800 AGGTCCTGGGACCTGGGTGGTGG + Intronic
1183480005 22:38058427-38058449 AGCAGTTGAGAGGTGGGAGGTGG + Intronic
1184473817 22:44710287-44710309 CCCTCCTGAGCGCTGGGGGGGGG - Intronic
1184637007 22:45840729-45840751 AGCTCCTGAGATCAGAGGGGTGG - Intronic
1184677209 22:46050257-46050279 GGCTCCTGAGAGCAGGGATCAGG + Exonic
1184697442 22:46147909-46147931 AGACCCTGAGTGCTGGGAGCAGG - Intergenic
1185100552 22:48838729-48838751 AGAGTCTGAGAGGTGGGAGGGGG + Intronic
1185173817 22:49307848-49307870 GGCTCCTGAGGGCAGTGAGGGGG + Intergenic
949598391 3:5572469-5572491 AGACCCTGACAGCTGGGAGCCGG - Intergenic
950494039 3:13323255-13323277 AGTACCTGGGAGCGGGGAGGTGG - Intronic
950759726 3:15210679-15210701 ATCACCTGAGCCCTGGGAGGTGG - Intronic
951098234 3:18656394-18656416 AGCTCCTGGAAGCTGAGGGGTGG + Intergenic
951503026 3:23411525-23411547 ACCTCCTGAGAGGAGCGAGGAGG + Intronic
952333215 3:32383700-32383722 AGCTTCACAGAGCTGGTAGGTGG + Intergenic
952620970 3:35342163-35342185 TGCTCCTGACAGCTTGGTGGTGG - Intergenic
952838497 3:37624947-37624969 AGCTAGGGAGAGCTGGGAAGGGG - Intronic
952981256 3:38738024-38738046 ATCACCTGAGACCAGGGAGGTGG - Intronic
954609938 3:51939039-51939061 TGCTCCTGGGAGCTGGGGGTAGG + Intronic
954808209 3:53232413-53232435 AACCCCTGAGAGCAGGCAGGTGG + Intronic
954924353 3:54219168-54219190 AGCTCTTGAGAGCTGGTACGAGG - Intronic
956456685 3:69428149-69428171 AGCTCTTCAGAGCTGGGAGTTGG + Intronic
957055137 3:75436543-75436565 AGCTCCTGCGGGGTGGGATGGGG + Intergenic
957394021 3:79617052-79617074 AGCTCATGAGCCCTGGGATGAGG + Intronic
957457622 3:80472686-80472708 GGCTGCACAGAGCTGGGAGGTGG - Intergenic
959018145 3:101159200-101159222 AGGTCCTGAGAGCTGGGCCTGGG - Intergenic
959637255 3:108589464-108589486 AGCTTCTGAGAGCGAGGGGGTGG - Intronic
960823160 3:121755914-121755936 AACTGCTGAGAGGTGGGAAGTGG + Intergenic
960852408 3:122069716-122069738 AGCTCCTGAGAAGTGTGTGGAGG - Intronic
961056453 3:123793025-123793047 AGCTCCTGAAAGCTTGTAGGAGG - Intronic
961212094 3:125133490-125133512 AGCTACTTAGGGGTGGGAGGTGG - Intronic
961494111 3:127278447-127278469 AGCTCCTGTGAGCTGGAGGGAGG + Intergenic
961536762 3:127575494-127575516 AGCTCCTCCGAGCTGGGGGCCGG + Exonic
961555588 3:127694859-127694881 CTATCCTGAGACCTGGGAGGTGG + Intronic
962860644 3:139397283-139397305 GGTACCTGAGAGGTGGGAGGTGG - Intergenic
963297194 3:143558840-143558862 AGAACATGAGATCTGGGAGGGGG + Intronic
964367827 3:155968601-155968623 AGCTCCTGACAGCTGTCAGCTGG + Intergenic
965487400 3:169294674-169294696 AGCTCCTTAGAGCTGGGGCTGGG - Intronic
965685157 3:171294822-171294844 AGCTACTGAGATTTGGGATGGGG - Intronic
965759013 3:172054815-172054837 AAGTCCTGAAAGCTGGAAGGAGG - Intronic
966961248 3:184941565-184941587 AGGTAGGGAGAGCTGGGAGGGGG + Intronic
967444967 3:189555406-189555428 TGCTCTTGGGAGCTGGGAGTAGG - Intergenic
967921517 3:194617606-194617628 AGCTCCTGAGGGCTGGGCAGGGG + Intronic
968003586 3:195224464-195224486 AGCTCCTAAGCTCTGGGAGAGGG - Intronic
968143086 3:196274305-196274327 AGCCACTGGGAGCTGGGAGTAGG - Intronic
968705538 4:2075765-2075787 AGCTCTGGGGAGCTGGGAGAAGG + Intronic
968817100 4:2827868-2827890 TCCTCCTGGGAGGTGGGAGGAGG - Intronic
969254277 4:5991857-5991879 AGCTCCAGGGAGCAGGGATGCGG - Intergenic
969258843 4:6021291-6021313 AGCCCCTGAGAGCTGGGGGGAGG + Intergenic
970157234 4:13153472-13153494 ATCTTCTGAAATCTGGGAGGAGG + Intergenic
971384184 4:26127938-26127960 AGCTCATGAAAGGTGGGAGCAGG - Intergenic
971477761 4:27088423-27088445 AGCTCCTGACAGCCGGAAGCTGG + Intergenic
971884207 4:32423119-32423141 AGCACCTGAGTCCTGGGATGTGG + Intergenic
972846516 4:42997881-42997903 AGTTCCCGAGAGGAGGGAGGAGG - Intronic
975465669 4:74706685-74706707 AGCCCCTGAGAGCTGGCAAATGG + Intergenic
979160716 4:117457316-117457338 CACTCCTGAAATCTGGGAGGTGG + Intergenic
979970665 4:127130699-127130721 AGCTCCTGAGACTTGGGACCTGG - Intergenic
981777440 4:148386119-148386141 CTCTCCTGGGGGCTGGGAGGAGG - Intronic
981825949 4:148941901-148941923 AGCACCTAGGAGGTGGGAGGTGG - Intergenic
982096742 4:151930388-151930410 AGCTCCCCAGAGCAGGAAGGAGG - Intergenic
982138936 4:152298998-152299020 AGGTTATGAGAGGTGGGAGGAGG + Intergenic
985492556 5:188021-188043 GGCTCCTGAGAGCAGGGCGGGGG - Exonic
985831735 5:2238935-2238957 AGCACCTTAGTGCTGGGTGGAGG + Intergenic
986339945 5:6780309-6780331 AGTACCTCAGAGCTGAGAGGAGG - Intergenic
986371610 5:7085956-7085978 GCCTCCTGAGAGCTGGTAAGAGG - Intergenic
987620701 5:20336199-20336221 AGCTGCTTGGAGCTGAGAGGGGG - Intronic
988404733 5:30809777-30809799 AGCACCTGAAAGCGGGGAGGGGG - Intergenic
990476898 5:56170136-56170158 AGCCTCTAGGAGCTGGGAGGAGG - Intronic
992643590 5:78791860-78791882 AGCCCCTAACAGCTGGGAAGTGG + Intronic
992772765 5:80063935-80063957 AGATCCTGGGAGGTGGGAGTTGG + Intronic
994087314 5:95773436-95773458 AGCTCCTGAGAGTTGGGGAGGGG + Intronic
995207913 5:109503765-109503787 AGAACCTATGAGCTGGGAGGAGG + Intergenic
995336170 5:111002210-111002232 AACCCTTGAGAGCTGGGATGAGG + Intergenic
997009289 5:129857931-129857953 AGATCCTGAGATCTGAGATGAGG + Intergenic
997122056 5:131184817-131184839 ATCTCCTGACACCTGGGAAGGGG - Intronic
997845320 5:137280865-137280887 GGCCTCTGAGCGCTGGGAGGAGG - Intronic
997956029 5:138279316-138279338 TGAACCTGAGAGCTGGGAGGCGG - Intergenic
998800474 5:145864158-145864180 AGCTTCTGAGATCTCAGAGGAGG - Intronic
999240924 5:150126961-150126983 AGCCCCTGAGGGCTGGGTTGTGG + Intronic
999516349 5:152305664-152305686 AACTCCACAGTGCTGGGAGGTGG - Intergenic
1000536622 5:162486001-162486023 AGCTCCTCAGAGCTAGGGGCGGG + Intergenic
1001171363 5:169422501-169422523 TGCTCCAGGGAGCTGGGAGCTGG - Intergenic
1001278252 5:170366563-170366585 AGCTTCTGAGAGCCTGAAGGTGG + Intronic
1001469925 5:172005370-172005392 GGCTCTGGAGAGCTGGGAAGAGG - Intronic
1002304747 5:178276560-178276582 CTCTAATGAGAGCTGGGAGGAGG - Intronic
1003273532 6:4628439-4628461 TGAACCTGGGAGCTGGGAGGTGG - Intergenic
1003977042 6:11354312-11354334 AGCTCCTGAGAGTGAGGAGCTGG - Intronic
1003986715 6:11442938-11442960 AGCTCCTGAGAGCAGCCAGGAGG + Intergenic
1004137528 6:12982211-12982233 AGCTGCAGAGAGCTGCCAGGAGG - Intronic
1004179652 6:13370142-13370164 AGCCCCAGAGAGCTGGTAGAAGG + Intronic
1005707107 6:28466491-28466513 AAGTCCTGAGAGATGGGAGCAGG + Intergenic
1005790481 6:29295446-29295468 GGCTCCTGTGTGCTGGGAGCAGG + Intergenic
1005790504 6:29295538-29295560 TGCTCTTGAGGGCTGGGAGCAGG + Intergenic
1007636633 6:43303637-43303659 AGCTACTGAGAGGTGGGAAGAGG + Intronic
1007706989 6:43797224-43797246 AGCTCCTGAGAGCTCTCAGCTGG - Intergenic
1008299300 6:49814739-49814761 AGTGCCTGAGATGTGGGAGGAGG - Intergenic
1008828029 6:55722421-55722443 TGAACCTGGGAGCTGGGAGGCGG + Intergenic
1008848412 6:55995858-55995880 AGCTGCCTAGAGCTGGGAGAGGG + Intergenic
1009846999 6:69146486-69146508 TGCTCTTGGGAGCTGGGAGCAGG - Intronic
1011459611 6:87589773-87589795 AGCTCCAGAGAAGGGGGAGGAGG + Intronic
1011742989 6:90381922-90381944 AGCTCCTGAAAGAATGGAGGGGG - Intergenic
1012838164 6:104296037-104296059 AGCAGCTTAGAGTTGGGAGGGGG - Intergenic
1013427984 6:110032509-110032531 AGACCCTGAGAGAGGGGAGGAGG + Intergenic
1015250398 6:131121558-131121580 ATCTCCTGAGCCCAGGGAGGTGG - Intergenic
1016385031 6:143522543-143522565 AGCTCCAGAGAGGTTAGAGGTGG - Intergenic
1017410724 6:154165251-154165273 AGCTTCTGAGTGCTGGGTGCGGG - Intronic
1017457321 6:154613450-154613472 AACTCCTAAGAGCTGTGAGCAGG - Intergenic
1018669031 6:166164534-166164556 ACTTGCTGAGAGCTGGGAAGTGG - Intronic
1018676477 6:166226534-166226556 AGCCCCTGGGGGCTGGGAGGTGG - Intergenic
1020418013 7:7968742-7968764 GGGTCCTGGGCGCTGGGAGGCGG + Intronic
1020760352 7:12261381-12261403 AGCCCCACAGAGCTGGGAAGTGG - Intergenic
1021861381 7:24909403-24909425 CATTCCTGAGAGCTGGGAGGTGG + Intronic
1021891366 7:25188919-25188941 AACTCCTGGGTGCTGGGAGAAGG + Intergenic
1022660905 7:32365444-32365466 TGTTCCTCAGACCTGGGAGGTGG - Intergenic
1022815064 7:33905463-33905485 GGCGCCCGAGAGCTGGGGGGCGG - Exonic
1022882290 7:34600724-34600746 GGCTCCTGAGAGGTGGCAGAAGG - Intergenic
1023167170 7:37354423-37354445 AGCTGCTGAGAGGTGAGAGGAGG + Intronic
1023876544 7:44289293-44289315 CTCCCCGGAGAGCTGGGAGGAGG + Intronic
1024320228 7:48059087-48059109 AGATACTGAGAGGTGGGAGCAGG - Intronic
1025689440 7:63746438-63746460 AGCCCCTGAGAGGTAAGAGGAGG - Intergenic
1025730161 7:64101356-64101378 TGCTGCACAGAGCTGGGAGGAGG + Intronic
1026832867 7:73621150-73621172 AATTCCTGAAAGGTGGGAGGTGG - Intronic
1027467667 7:78535889-78535911 AGTTCCTGAGTGTTGGGGGGAGG - Intronic
1028379007 7:90177021-90177043 AGCTGGTGAGAGCTGGGAACAGG - Intronic
1028666466 7:93349281-93349303 AGCTTGTTAGAGTTGGGAGGAGG + Intronic
1029440472 7:100584366-100584388 TGCTCCTGTGAGCTTGGGGGGGG - Intronic
1029451996 7:100646642-100646664 AGGCCCTGAGAGCAGGGAGAAGG + Exonic
1030064501 7:105648932-105648954 AGGTGGTGAGACCTGGGAGGGGG + Intronic
1030516512 7:110544985-110545007 AGCACCTGAAAGTTGTGAGGAGG - Intergenic
1031435613 7:121728646-121728668 AGCTTCTGAGATCTGGATGGGGG + Intergenic
1032015682 7:128379132-128379154 AGCCCCAGAGAGCTGGGCTGAGG - Intergenic
1032266138 7:130371277-130371299 TGCCTCTGAGAGCTGTGAGGAGG - Intergenic
1032536461 7:132668694-132668716 AGCCCCAGGGTGCTGGGAGGAGG + Intronic
1032549993 7:132776211-132776233 AGAACCTGAGTGATGGGAGGAGG - Intergenic
1032744437 7:134771537-134771559 AGCACCTGTCACCTGGGAGGGGG + Intronic
1032961960 7:137046018-137046040 AGATCTTCAAAGCTGGGAGGTGG + Intergenic
1033305769 7:140224270-140224292 AGCTCCTGAGAGGGAGGAGGAGG - Intergenic
1034309150 7:150071700-150071722 AGCTGCTCAGAGCTTGGAAGAGG + Intergenic
1034531905 7:151701089-151701111 AGCCCCTGAGGAGTGGGAGGTGG - Intronic
1034797705 7:154028936-154028958 AGCTGCTCAGAGCTTGGAAGAGG - Intronic
1035118333 7:156543895-156543917 CGCTCCGGAGAGCTGCGAGGTGG + Intergenic
1035152215 7:156884178-156884200 AGCCCCTGACATCTGGGAGCTGG + Intronic
1035235818 7:157497111-157497133 AGCACCCGTGAGCGGGGAGGAGG - Intergenic
1035254858 7:157619776-157619798 ACTTCCTGAGGGCTGGAAGGAGG + Intronic
1035338145 7:158143309-158143331 AGCCCCAGAGAACTGGCAGGAGG + Intronic
1035629679 8:1097890-1097912 CTCTCCTGAGCGCAGGGAGGTGG - Intergenic
1036635733 8:10548511-10548533 GGGTCCTGGGAGCTGGGAGACGG + Intronic
1037523664 8:19703890-19703912 GGCTCCTGAGAGCTGCGTGTAGG - Intronic
1037662174 8:20937323-20937345 AGATCCAGAGAGATGGGAGCAGG + Intergenic
1037972801 8:23186146-23186168 ATCACCTGAGCCCTGGGAGGTGG + Intergenic
1038324789 8:26564662-26564684 AGCTGCTGAGAGGTGTGAGAGGG + Intronic
1038550595 8:28465270-28465292 AGCTCCTCAGAGCTGAGCAGAGG + Intronic
1039598209 8:38809797-38809819 AGCTCCTGACAGCTGAGTGTTGG + Intronic
1040523307 8:48196342-48196364 AGCAACTCAAAGCTGGGAGGGGG - Intergenic
1041121456 8:54590495-54590517 GGGTCCTGAGAGCTTTGAGGAGG - Intergenic
1041272320 8:56121523-56121545 AGCTGTTGTGAGATGGGAGGCGG + Intergenic
1044124369 8:88438792-88438814 AGCTGCTGGGAGCTGGGGGAGGG - Intergenic
1046818011 8:118606772-118606794 AGCCTCTGAGAGCAGGAAGGAGG + Intronic
1047034880 8:120926714-120926736 AGATCTTGAGAGCATGGAGGTGG + Intergenic
1048426321 8:134327349-134327371 AGCCCTTGAGAGCTAGGAAGAGG + Intergenic
1049204020 8:141355029-141355051 AGCACCCGAGAGCTGGGGGCTGG + Intergenic
1049208997 8:141376712-141376734 ATTTCCTGAGAGCAGGGTGGGGG - Intergenic
1049325702 8:142020377-142020399 AGCACCTGGGAGCTGTGGGGAGG + Intergenic
1049357075 8:142194184-142194206 AGGAGCTCAGAGCTGGGAGGAGG - Intergenic
1049469925 8:142770729-142770751 GGCTCCTTATGGCTGGGAGGTGG + Intronic
1049694274 8:143976002-143976024 AGGTCGAGAGAGCTTGGAGGTGG - Intronic
1049901450 9:170470-170492 ATCGCTTGAAAGCTGGGAGGCGG - Intronic
1050158044 9:2688751-2688773 AGCCCCTGATAGTTGGGAGCTGG + Intergenic
1050750959 9:8936296-8936318 AGCTCCTGGGGGTTGGCAGGGGG + Intronic
1051272651 9:15370661-15370683 AGCTCCCGAGAGTGAGGAGGAGG - Intergenic
1051477567 9:17524863-17524885 AGCCCCTGACACCTGGGAGACGG + Intergenic
1052827504 9:33187746-33187768 AGCTCCAGAGAGTTGGCTGGAGG - Intergenic
1053436428 9:38078113-38078135 CCCTCCTAAGAGGTGGGAGGTGG + Intergenic
1053445510 9:38150238-38150260 TGCTCCTGGAAGGTGGGAGGTGG + Intergenic
1053744485 9:41180765-41180787 ATCGCTTGAAAGCTGGGAGGCGG - Intronic
1054349753 9:64010655-64010677 ATCGCTTGAAAGCTGGGAGGCGG - Intergenic
1054482785 9:65684448-65684470 ATCGCTTGAAAGCTGGGAGGCGG + Intronic
1054683859 9:68250485-68250507 ATCGCTTGAAAGCTGGGAGGCGG + Intronic
1054771996 9:69091813-69091835 GCCTCCTGATAGCTGGGATGAGG - Intronic
1056330380 9:85516410-85516432 ATCTCCTGGGGGCTGGGAGTGGG + Intergenic
1056473043 9:86924537-86924559 TCCTTCTGAGGGCTGGGAGGAGG + Intergenic
1057114534 9:92508012-92508034 AGCTCCAGAGAGGGGGAAGGAGG - Intronic
1057695292 9:97318689-97318711 AGGGCCAGAGAGCTGGGAGTTGG - Intronic
1057695369 9:97319104-97319126 AGGGCCAGAGAGCTGGGAGTTGG + Intronic
1058012905 9:99998309-99998331 AGATCCTGAGAACAGGGAAGAGG - Intronic
1058773988 9:108266160-108266182 TGCTCCAGGTAGCTGGGAGGTGG - Intergenic
1059175526 9:112166760-112166782 AGGGCCTGAAAGCAGGGAGGTGG + Intronic
1060665763 9:125431176-125431198 AGCTCCTAGGAGCTGGGGTGGGG + Intergenic
1060881850 9:127122952-127122974 AGCTCCCGCGTGCTGCGAGGCGG + Intronic
1060967181 9:127717806-127717828 AGCCCCTGAGAAGTGTGAGGTGG - Intronic
1061537264 9:131257925-131257947 AGGGCCTGGGAGATGGGAGGAGG - Intergenic
1061808061 9:133147535-133147557 AGCTGCTCAGAGGCGGGAGGGGG - Intronic
1062067665 9:134537423-134537445 TGCTCCTGGAAGATGGGAGGGGG - Intergenic
1062123788 9:134848657-134848679 AGCTAGTGAGAGCTAGGAGGTGG - Intergenic
1062483928 9:136764890-136764912 AGCTGCAGAGAGCTGGGCTGGGG + Intronic
1062599063 9:137311953-137311975 AGCCCCCGAGTGCTGGGGGGCGG - Intronic
1062695966 9:137876760-137876782 AGCTGCTGCTAGCTGGGAAGCGG + Intergenic
1062732132 9:138115888-138115910 AGCCCCTGAGAACTGAGATGTGG - Intronic
1185822734 X:3220417-3220439 AGCTCCCAGGAGCTGGGAGAGGG - Intergenic
1186461684 X:9753269-9753291 AGTTCCTGGAACCTGGGAGGTGG + Intronic
1186467349 X:9794043-9794065 TGCTCCTCAGAGCGGGGAAGAGG - Intronic
1186670170 X:11759037-11759059 AGCTCCTCAGATTTGGGTGGCGG + Intronic
1187261174 X:17686583-17686605 TGCTCATGACAGCTGGGAGAAGG - Intronic
1187295269 X:17993257-17993279 TGCTGCTGAGAGCTGAGATGAGG - Intergenic
1189226714 X:39419423-39419445 AGCTCTTAAGAGCTGGCAGGAGG - Intergenic
1189330091 X:40139115-40139137 AGGTGCTGGGGGCTGGGAGGAGG + Intronic
1189777927 X:44486883-44486905 AGTTTCTGATAGCTAGGAGGAGG + Intergenic
1190329342 X:49226144-49226166 AGGTCATGAGGGCTTGGAGGTGG + Intronic
1191947243 X:66548421-66548443 AGTTCCTGAGTGATGGGATGGGG - Intergenic
1192142244 X:68655644-68655666 AGCTCAAGAGAGTTGTGAGGTGG + Intronic
1192182913 X:68927455-68927477 AGCTAGTGAGTGCTGGGAGGAGG + Intergenic
1192201259 X:69068102-69068124 AGCTCCTGGAAGCTGGAAGCAGG - Intergenic
1192596130 X:72410289-72410311 CTGTTCTGAGAGCTGGGAGGAGG + Intronic
1195320758 X:103719937-103719959 AGCTCCAGACAGCGGGGAGCAGG + Intronic
1195930085 X:110065584-110065606 TGCTCCTGAGGGGTGGGATGGGG + Intronic
1201639541 Y:16164579-16164601 TGCTCTTGAGAACTGGGTGGCGG + Intergenic
1201663272 Y:16420745-16420767 TGCTCTTGAGAACTGGGTGGCGG - Intergenic