ID: 1069898213

View in Genome Browser
Species Human (GRCh38)
Location 10:71691972-71691994
Sequence GGAAGCTCCTGAGAGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 388}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069898213_1069898227 27 Left 1069898213 10:71691972-71691994 CCTCCCAGCTCTCAGGAGCTTCC 0: 1
1: 0
2: 2
3: 37
4: 388
Right 1069898227 10:71692022-71692044 TCTCAGAGTCATGTCATGAATGG No data
1069898213_1069898221 3 Left 1069898213 10:71691972-71691994 CCTCCCAGCTCTCAGGAGCTTCC 0: 1
1: 0
2: 2
3: 37
4: 388
Right 1069898221 10:71691998-71692020 ACAGTGAGCCCTCATTCCCAGGG No data
1069898213_1069898222 4 Left 1069898213 10:71691972-71691994 CCTCCCAGCTCTCAGGAGCTTCC 0: 1
1: 0
2: 2
3: 37
4: 388
Right 1069898222 10:71691999-71692021 CAGTGAGCCCTCATTCCCAGGGG No data
1069898213_1069898220 2 Left 1069898213 10:71691972-71691994 CCTCCCAGCTCTCAGGAGCTTCC 0: 1
1: 0
2: 2
3: 37
4: 388
Right 1069898220 10:71691997-71692019 CACAGTGAGCCCTCATTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069898213 Original CRISPR GGAAGCTCCTGAGAGCTGGG AGG (reversed) Intronic
900358505 1:2276292-2276314 GTGAACTTCTGAGAGCTGGGTGG - Intronic
900570704 1:3356912-3356934 CGAGTCTCCTGAGAGCCGGGTGG + Intronic
901337824 1:8466318-8466340 GGAATGTCCTGAGCACTGGGCGG - Intronic
901655724 1:10768120-10768142 GGAGCCTCCTGAGATCAGGGCGG - Intronic
901875806 1:12166708-12166730 GGAAGCCTGTGGGAGCTGGGAGG + Intergenic
902138294 1:14330046-14330068 TCAAGCTCCTGACAGCTGTGTGG + Intergenic
902599196 1:17529668-17529690 GGAAGTTCCTGGGAGCTCAGAGG + Intergenic
902625213 1:17672450-17672472 GGCAGCTCCTGGGCGCTGGGAGG - Intronic
902631029 1:17704769-17704791 GGGAGCATCTGAGAGCAGGGGGG - Intergenic
902783748 1:18720221-18720243 TGGAGCATCTGAGAGCTGGGAGG - Intronic
902838150 1:19059691-19059713 GCAAGCTGCTGTGAGATGGGAGG - Intergenic
906032263 1:42731091-42731113 TGAAGCTGGTGAGAGCTGTGTGG - Intergenic
906913065 1:49977266-49977288 TGAAGCTCATGAAAGATGGGAGG - Intronic
906927059 1:50128991-50129013 TGAAGATCCTGAGAGATAGGTGG - Intronic
907152950 1:52306087-52306109 GGAAGGGCCTGAAGGCTGGGGGG + Intronic
909369839 1:74870867-74870889 GGAAGCACATGAGATTTGGGAGG + Intergenic
910467202 1:87513016-87513038 GAAAGTTCCTGAGGGCTGTGTGG - Intergenic
912415372 1:109504842-109504864 TGGAGCTCCTGAGGACTGGGAGG - Exonic
912980230 1:114364787-114364809 CGCAGCACCTGAGACCTGGGAGG - Intergenic
913176766 1:116280036-116280058 GCATGTTCCTGACAGCTGGGCGG - Intergenic
913573115 1:120141456-120141478 GGAAGCTCCTTAGACCTCAGAGG - Intergenic
914294371 1:146306253-146306275 GGAAGCTCCTTAGACCTCAGAGG - Intergenic
914555415 1:148757036-148757058 GGAAGCTCCTTAGACCTCAGAGG - Intergenic
915216263 1:154342700-154342722 GGAGCCTACTGAGAGTTGGGAGG + Intronic
916677789 1:167078450-167078472 TGAGGCTCCTGAGAACTGTGAGG - Intronic
917339584 1:173961401-173961423 GGAAGATCTTGAGAGTTTGGGGG - Intronic
919348827 1:196421813-196421835 GGATCTTCCTGAGAGCTGTGAGG + Intronic
919761170 1:201099146-201099168 GGAAGATGATGAGAGCTGGTTGG + Intronic
920312841 1:205058605-205058627 GAAAGCTCATGAAGGCTGGGGGG + Exonic
920456897 1:206108419-206108441 GGAGGCTTCTTAGAGCTGAGTGG + Intergenic
920780785 1:208989117-208989139 GGGAGCTCCAGAGAGCCGGAGGG - Intergenic
922172433 1:223167050-223167072 AGAGGCTCCTTAGAGGTGGGTGG - Intergenic
922558467 1:226550019-226550041 GGCTGCTCCTGCGTGCTGGGAGG + Intronic
922874832 1:228932358-228932380 GGAAGATCCTGAGCCATGGGAGG + Intergenic
923718713 1:236449030-236449052 GGACTCTCCTGAGGGCTGTGAGG + Intronic
924027121 1:239845554-239845576 GGAACTACATGAGAGCTGGGCGG - Intronic
1062792380 10:316686-316708 AGGGGCTCCTGAGGGCTGGGAGG - Intronic
1063059565 10:2537435-2537457 CGCAGCTCCTGAGAGCAGGAAGG + Intergenic
1063096533 10:2913458-2913480 GAATGCTCCTGAGACCCGGGAGG - Intergenic
1063551918 10:7041704-7041726 GGTTCCTCCTGAGAGCTGTGAGG + Intergenic
1065636861 10:27743001-27743023 GGCAGCTCCAAAGAGCTTGGTGG - Intronic
1067575043 10:47403721-47403743 GGGAGCTCCAGAGAGCTGTGGGG + Intergenic
1067582261 10:47453104-47453126 GGGAGCTCCAGGGAGCTGAGGGG - Intergenic
1067768995 10:49110114-49110136 GGAAGCTCTTGAGGGCGGGGTGG - Intronic
1069892837 10:71662645-71662667 GGAAGGGCCTGAGAGATGTGGGG - Intronic
1069898213 10:71691972-71691994 GGAAGCTCCTGAGAGCTGGGAGG - Intronic
1069939441 10:71944358-71944380 CGCAGCACCTGAGACCTGGGAGG + Intergenic
1070718427 10:78739532-78739554 GGAAACACCTGAGACCAGGGAGG - Intergenic
1071189723 10:83084995-83085017 GGAACCAACTGAGAGCTGAGAGG + Intergenic
1072537021 10:96371621-96371643 TCAAATTCCTGAGAGCTGGGTGG + Intronic
1072898461 10:99387527-99387549 GGCATCTTCTGAGAGCAGGGTGG - Intronic
1074196748 10:111195641-111195663 TGAACCTGCTGAAAGCTGGGTGG - Intergenic
1074601428 10:114917631-114917653 GTGAGCTCCAAAGAGCTGGGTGG + Intergenic
1075162089 10:120033288-120033310 TGAAGCCCCTGAGGGCTGTGAGG - Intergenic
1075694597 10:124424469-124424491 CGAGGATCTTGAGAGCTGGGGGG + Intergenic
1076461199 10:130648799-130648821 GGGAGCCCCTGAGAGCTTGCTGG - Intergenic
1076574901 10:131458070-131458092 GCAAGCACCACAGAGCTGGGGGG + Intergenic
1076589313 10:131572250-131572272 CCAGGTTCCTGAGAGCTGGGTGG - Intergenic
1077333357 11:1993004-1993026 GGCAGCCCCTGAGTGCTGGAGGG - Intergenic
1078107998 11:8370710-8370732 GGTAGCTCCTGGGGGCTGGAGGG + Intergenic
1079094106 11:17500004-17500026 GGAAGCTCCTGAGTCCTTTGTGG - Intronic
1081529650 11:43949205-43949227 GGAAGCTGCTGGGAGTTGGAGGG - Intergenic
1081601892 11:44501100-44501122 GGTTCCTTCTGAGAGCTGGGAGG - Intergenic
1083777315 11:64900595-64900617 GGGAGCTCCTGGGACCTGAGAGG + Exonic
1084673412 11:70620754-70620776 AGAAACTCCAGAGAGCTTGGTGG + Intronic
1084710393 11:70840460-70840482 GGATGCTCCTCAGAGCTGAGAGG - Intronic
1085239968 11:75044969-75044991 CGCAGCACCTGAGACCTGGGAGG + Intergenic
1085394194 11:76198425-76198447 GGAGGCTGGCGAGAGCTGGGAGG - Intronic
1086402699 11:86473561-86473583 GTGAGATCCTGAGAGCTAGGAGG + Intronic
1088770614 11:113032325-113032347 GTAAGCCCCTGAGATCTGGGTGG - Intronic
1089160555 11:116433933-116433955 GCAAGTCTCTGAGAGCTGGGTGG + Intergenic
1089706741 11:120283562-120283584 GGAAGCTCCCGAAAGCAGAGAGG + Intronic
1089916758 11:122164631-122164653 GGTAGCTCCTGAGGGCTAAGGGG - Intergenic
1090599894 11:128359117-128359139 GGAAGGGCATGAGAGCTGTGTGG - Intergenic
1090669857 11:128938568-128938590 GGATGGTCCTGAAAGCTGAGAGG - Intronic
1202816335 11_KI270721v1_random:48185-48207 GGCAGCCCCTGAGTGCTGGAGGG - Intergenic
1093409369 12:18845738-18845760 GAAAGGTCCTGGGAGCTGGCTGG - Intergenic
1094613507 12:32015936-32015958 GGAAGCTGCAGGGAGCTGTGAGG + Intergenic
1095487460 12:42699836-42699858 GGCAGCTCCAGGGAGCTGCGTGG - Intergenic
1096110295 12:49024783-49024805 GGAAGGGGCTGGGAGCTGGGGGG - Intronic
1096518369 12:52170669-52170691 AGAAGCTGCTGGGAGCTGGCTGG + Exonic
1096561209 12:52437309-52437331 GGAGGCTAGTCAGAGCTGGGAGG - Intergenic
1096561685 12:52440078-52440100 GGGAGCTCATGATACCTGGGAGG + Intergenic
1096784062 12:54007130-54007152 GGCAGCTCCTGAGATGGGGGTGG + Intronic
1097431621 12:59515366-59515388 GGAAGGGCATGTGAGCTGGGAGG + Intergenic
1098275181 12:68805444-68805466 GGAGGTTGCTGAGAGCTGGGAGG - Intergenic
1098452965 12:70641179-70641201 GGTAGCTCCAGGGAGCTGAGAGG + Intronic
1100616439 12:96235115-96235137 GGAGGCCGCCGAGAGCTGGGAGG - Intronic
1102868207 12:116391242-116391264 GGAAGATCCTGAGATCTTGAAGG + Intergenic
1103181677 12:118917731-118917753 GGAAGCCCCCGAGAGCAAGGAGG + Intergenic
1103732645 12:123038034-123038056 GGAGGCTCCTGGCACCTGGGTGG + Intronic
1104273754 12:127306002-127306024 GTAAGCCACTGAGATCTGGGAGG - Intergenic
1104293113 12:127486902-127486924 TGCAGCACCTGAGACCTGGGAGG + Intergenic
1104760579 12:131295550-131295572 GAAAGCTCCTGGGAACAGGGTGG - Intergenic
1104819196 12:131665235-131665257 GAAAGCTCCTGGGAACAGGGTGG + Intergenic
1104918910 12:132280519-132280541 GGAAGCTTCTGAGAGCGGTTAGG + Intronic
1104921474 12:132292846-132292868 GGACACTCATGAGAGCTGTGCGG + Intronic
1104988589 12:132611415-132611437 GGAAGCTCCTGGGTGCATGGTGG + Intergenic
1105286837 13:19011598-19011620 ATAAGATCCTGAGAGGTGGGAGG + Intergenic
1105792545 13:23816781-23816803 GGGTGCTCATGAGAGCAGGGTGG - Intronic
1107126121 13:36848918-36848940 CGTAGCTCCTGAGACCTGAGAGG + Intronic
1107150787 13:37108186-37108208 AGAGGCTCCTGAACGCTGGGTGG + Intergenic
1107241873 13:38245214-38245236 AAAAGCTCAGGAGAGCTGGGAGG - Intergenic
1110545132 13:76747448-76747470 AGATGCTCTTCAGAGCTGGGAGG + Intergenic
1112565915 13:100551469-100551491 GGAAGTTCCTGGGAGCCGAGGGG - Intronic
1113389809 13:109884790-109884812 GGGAGCCTCTGAGACCTGGGAGG - Intergenic
1113581629 13:111434124-111434146 GGATGATCATGAGAGCTGGCAGG + Intergenic
1113614685 13:111671770-111671792 GGAAGCTCCGGAGAGAGGCGGGG + Intronic
1113620154 13:111756684-111756706 GGAAGCTCCGGAGAGAGGCGGGG + Intergenic
1113769293 13:112898257-112898279 GGAAGCTGCTGAGGACTGGGTGG - Intronic
1114458993 14:22875140-22875162 GGCAGCTGCAGAGGGCTGGGAGG - Exonic
1118806048 14:69237764-69237786 GGAAGATCCTGAGCGCCGGCAGG + Exonic
1118865618 14:69701384-69701406 GGCAGCTCCTGAAAGCAGGCAGG - Intronic
1118872596 14:69755668-69755690 GGCATCTCATGAGATCTGGGAGG + Intronic
1118911434 14:70065202-70065224 GGAAGCTCAGGAGGGCAGGGAGG - Intronic
1118980203 14:70710091-70710113 GGAATATCCTGGGAGGTGGGTGG - Intergenic
1119663631 14:76468438-76468460 GGAAGATCCTGTGAGCTGTCAGG - Intronic
1120644007 14:87050542-87050564 TGAAGTTACTGAGAGCTGGAAGG - Intergenic
1121224442 14:92311013-92311035 GGAAGCTGCTGAGAAGCGGGAGG + Intergenic
1122314956 14:100820490-100820512 AGAAGCTCATGAGGGCTCGGGGG - Intergenic
1122367297 14:101201694-101201716 GGATCCTCATGCGAGCTGGGAGG + Intergenic
1122589925 14:102841325-102841347 GGAAGCACCTCAAGGCTGGGAGG + Intronic
1122905047 14:104797749-104797771 GGAGGCCCCTGAGCTCTGGGAGG - Intergenic
1122978091 14:105179203-105179225 GGAGGCTGCTGAGGCCTGGGAGG + Intronic
1123912230 15:24979090-24979112 GGAAGATCCTGGGTACTGGGAGG + Intergenic
1124351105 15:28956201-28956223 GCAAGCCCCAGAGGGCTGGGAGG - Intronic
1125356913 15:38825996-38826018 GGAAGCCACTGAGGGCAGGGTGG + Intergenic
1125606231 15:40941478-40941500 GGAAGCTACGGAGAGCTCTGTGG - Intergenic
1127855392 15:62949736-62949758 GGAACCCGCTGAAAGCTGGGAGG + Intergenic
1128199355 15:65791854-65791876 GAGAGCTCCTGAGATCCGGGAGG - Intronic
1128585295 15:68844071-68844093 GGCGGCTCCTGAGAGCTCGCTGG + Intronic
1129712922 15:77830153-77830175 GGAAGCACCAGAGAACTTGGAGG - Intergenic
1129854233 15:78812193-78812215 GGAAGCTCCTGGGAGCACAGGGG - Intronic
1130926842 15:88391878-88391900 GGAAGCACAGAAGAGCTGGGTGG + Intergenic
1132629562 16:910615-910637 GGAAGCTCAGGAGGGCTGGTGGG + Intronic
1132783096 16:1639197-1639219 AGAAGCTTCTGAGAGGTGGAGGG + Intronic
1132896883 16:2233438-2233460 GGGAGCTCCTGGGAGACGGGGGG - Exonic
1133116118 16:3578891-3578913 GGAACCTGCTGGGTGCTGGGAGG + Intergenic
1133760716 16:8796482-8796504 GGAGGATCCTAAGAGGTGGGTGG - Exonic
1133983812 16:10653014-10653036 GGAAGCCCCTCAGAGCTTGGGGG - Intronic
1135086241 16:19476737-19476759 CGAAGCCACTGAGATCTGGGGGG - Intronic
1135763712 16:25158566-25158588 GAATGCTTCTGAGAGCTGGTGGG - Intronic
1136079019 16:27839317-27839339 GGAAGCTTATAAGAGCTGGAGGG - Intronic
1137041443 16:35616443-35616465 TGCAGCACCTGAGACCTGGGAGG - Intergenic
1137499932 16:49003060-49003082 GGAGCCTCCTGTGACCTGGGAGG - Intergenic
1137502731 16:49023971-49023993 AGTAGCTCCTGGGAGCTGGCAGG + Intergenic
1138124635 16:54428742-54428764 GGTGGCTTCAGAGAGCTGGGTGG - Intergenic
1138276213 16:55736795-55736817 GGAGACTCCTGTGTGCTGGGAGG - Intergenic
1139147135 16:64339003-64339025 GGAAACTCCAGAGAGATAGGGGG + Intergenic
1139951986 16:70677010-70677032 GGCAGCTCCTCAGAGCTAGTAGG + Intronic
1141097817 16:81175336-81175358 GGAGGGTCCTGGGAGCTGGTGGG - Intergenic
1141699753 16:85636926-85636948 GGTAGCACCAGGGAGCTGGGGGG - Intronic
1141712525 16:85708268-85708290 GGAGGTTCCTGAACGCTGGGAGG - Intronic
1142003059 16:87675154-87675176 GAAAGCTTCTGCCAGCTGGGGGG - Intronic
1142484255 17:236533-236555 GTGAGGTCCTGAGAGCGGGGTGG + Intronic
1142509944 17:386742-386764 AGCAGCTCCTGGGGGCTGGGGGG - Intergenic
1142719089 17:1764344-1764366 GCAGGCTCCTGGCAGCTGGGTGG + Intronic
1144701772 17:17345082-17345104 TGGTGCTCCTGGGAGCTGGGAGG + Intronic
1146428923 17:32772571-32772593 CTAAGCTCCTGCCAGCTGGGTGG + Intronic
1146660923 17:34664804-34664826 GGAAGCTCTTGAGAACTGGGTGG - Intergenic
1146704584 17:34991721-34991743 GGAGGCTCTTGGCAGCTGGGGGG - Exonic
1147696590 17:42359438-42359460 GGGAGGTCAGGAGAGCTGGGTGG + Intronic
1148107873 17:45128854-45128876 GGACGCTCCTGGGGGCTGGCAGG + Intronic
1148245341 17:46026504-46026526 GGAAGCCACTGCCAGCTGGGGGG + Exonic
1148501718 17:48096707-48096729 GGAAGCTGCAGTGAGCTGAGTGG + Intronic
1148688475 17:49513533-49513555 GGAGGCTTGTCAGAGCTGGGAGG + Exonic
1149394206 17:56222203-56222225 GGAGGATCCTGAGAACTTGGAGG + Intronic
1149420093 17:56502190-56502212 GGAAGGTTCTGTGAGCTGAGAGG - Intronic
1149427713 17:56570688-56570710 GGAAGCCCCAGGGAGCTGGAAGG - Intergenic
1149427890 17:56572366-56572388 GGAAGCCTCTGAGGGCTGGAAGG - Intergenic
1149999620 17:61425645-61425667 GGAAGCAGCAGAGAGCTGAGGGG - Intergenic
1150461379 17:65356567-65356589 GGAGGCTCAGGAGACCTGGGAGG - Intergenic
1151343861 17:73489500-73489522 GGAAGCTCCGGCCATCTGGGCGG - Intronic
1151417135 17:73973867-73973889 GGCAGCTCCAGAGGCCTGGGGGG - Intergenic
1151431427 17:74066181-74066203 GGAAGCTCCTGCGCTGTGGGGGG + Intergenic
1151829236 17:76540051-76540073 AGTGGCTCCTGAGAGCTGGCTGG + Intronic
1152089943 17:78240728-78240750 GGAAGCTCCTGGGGGCTTGAGGG + Exonic
1152158038 17:78647755-78647777 GGAGGCTCCGGAGGGCAGGGAGG + Intergenic
1152243138 17:79170464-79170486 GGGGGCTCTTGAGGGCTGGGGGG + Intronic
1152457415 17:80424226-80424248 GCAGGCACCTGAGAGCTAGGAGG - Intronic
1152464267 17:80456940-80456962 GGCAGCTGCAGAGAGCTGGACGG - Intergenic
1152608966 17:81306396-81306418 GAGAGCTCCTGAGGCCTGGGAGG - Intergenic
1152746696 17:82043632-82043654 GGACCATCCTGAGAGCTGGAAGG - Intergenic
1157510634 18:48269723-48269745 GGAGACTCCTGGGAGCTGAGGGG + Intronic
1157857137 18:51113591-51113613 GGGAGCTCCTAAGCTCTGGGGGG - Intergenic
1158362655 18:56692973-56692995 GGAAGATCCTTTGAGCTGGGAGG + Intronic
1158448252 18:57539965-57539987 GGAGGCTGCTGAGAGCTGTTTGG + Intergenic
1158882974 18:61798813-61798835 GGGAGGTCCAGAGAGCTAGGTGG + Intergenic
1160190056 18:76708364-76708386 GGAGGCTCCTGAGGCCTGGGTGG - Intergenic
1160370441 18:78368507-78368529 GGAGGCTCCGGAAAGCTGGTGGG + Intergenic
1160704615 19:524206-524228 GGAGGCCCCGGGGAGCTGGGCGG - Intergenic
1161015139 19:1979633-1979655 GGAAGCCCCTGGTAGGTGGGGGG + Exonic
1161123117 19:2540985-2541007 GGAGGCTTCTGAGAGCTGGCCGG + Intronic
1162104950 19:8364591-8364613 GTTAGCCCCTGAGAGCCGGGTGG + Exonic
1163065260 19:14787589-14787611 GGAGACTACTGTGAGCTGGGAGG + Intergenic
1163427630 19:17247891-17247913 CGAGGCAGCTGAGAGCTGGGTGG + Intronic
1164908554 19:31986937-31986959 GGGAGCTGTGGAGAGCTGGGAGG - Intergenic
1165944775 19:39435527-39435549 TGTAGCTCTTGAAAGCTGGGGGG - Intronic
1166741021 19:45114877-45114899 GGAAGCTCCTTCCAGCTGGGGGG + Intronic
1167438057 19:49491331-49491353 CGGAGCTGTTGAGAGCTGGGAGG - Intronic
1167786685 19:51643491-51643513 GGAAGCTCCTGAGTTCCAGGTGG - Intronic
1168056525 19:53867870-53867892 GGAAGGGTCTGAGGGCTGGGTGG - Intronic
925798017 2:7567866-7567888 GGGAGCCCCTCAGAGCTGGTGGG - Intergenic
926908924 2:17830925-17830947 GGACTCTGCTGAGGGCTGGGAGG + Intergenic
927094462 2:19736995-19737017 GTGAGCTCCTGAGGGCTGAGAGG - Intergenic
927715510 2:25349462-25349484 GGCTGCTCCTGAGGGCTGAGGGG + Intergenic
927857689 2:26537575-26537597 GGAAGCAGCTGAGAGGTGAGGGG + Intronic
927874552 2:26646727-26646749 GGTAGCTGCTGGGAGCTGGGGGG + Intergenic
928119781 2:28575455-28575477 GGATGGTGCTGAGAGCTGGAAGG - Intronic
928317559 2:30257857-30257879 GGAAGCTGCTTAGAGCCAGGGGG + Exonic
928376271 2:30777163-30777185 AGGAGCTGCTGAGAGCTGGAGGG - Intronic
929087607 2:38183778-38183800 GGAATTGCTTGAGAGCTGGGAGG - Intergenic
929804718 2:45134906-45134928 GGAAGTGACTGAGAACTGGGAGG + Intergenic
930518744 2:52436849-52436871 TGCAGCACCTGAGACCTGGGAGG + Intergenic
931698240 2:64888282-64888304 CGCAGCACCTGAGACCTGGGAGG - Intergenic
933199994 2:79437399-79437421 GGCAGCACCTGGGAGCTGTGAGG - Intronic
934053244 2:88227797-88227819 GGAAGCTGCTGGGAGATGGCTGG + Intergenic
936750664 2:115637739-115637761 GGAGGCCCCTGTGACCTGGGGGG + Intronic
937988717 2:127650428-127650450 TGAGGCTCCTCAGAGCTGGGAGG - Intronic
939106397 2:137953346-137953368 GGAAGGTCCTGAGGGTAGGGAGG + Intergenic
941424732 2:165328363-165328385 GCAAGCTACTGGCAGCTGGGGGG - Intronic
941629032 2:167864096-167864118 TGAAGATGCTGAGAGCAGGGTGG - Intergenic
942947308 2:181684243-181684265 GGAGGCTCTTGAGAGCTTCGGGG + Intergenic
943022980 2:182597521-182597543 GGAGGGTCCTGAGAGGTGTGGGG + Intergenic
943283071 2:185962929-185962951 AGAAGGTCATGAGAACTGGGAGG - Intergenic
946115023 2:217453750-217453772 GGATGGTGCTGAGAGCTGGCTGG + Intronic
947106172 2:226669998-226670020 GGTAGCTCCTGGGAGCTGAGAGG - Intergenic
1169195921 20:3681975-3681997 GGAGGCCCCGGAGAGCTCGGGGG - Exonic
1171086179 20:22240115-22240137 TGAAACTCCTGAGAGCTGAAGGG - Intergenic
1171379557 20:24724108-24724130 GGAATTTCCTGAGAGGTTGGTGG + Intergenic
1172773229 20:37393384-37393406 GGGAGCTGGTGAGACCTGGGTGG - Intronic
1173047942 20:39530532-39530554 GGAGGCTCCTGAGAGCTCAGAGG - Intergenic
1173552757 20:43944709-43944731 GGAAGCACCACAGAGCTGAGAGG - Intronic
1173727236 20:45306670-45306692 GGTCGCTCCTGAGAGCAGGCGGG - Intronic
1175163478 20:57026117-57026139 GAGAGCTCCTGACAGCAGGGAGG + Intergenic
1175422018 20:58840641-58840663 TGGGGCTCCTGAGTGCTGGGCGG - Intronic
1175445463 20:59016572-59016594 GGAGGCTCGGGAGAGCTGGTGGG + Intergenic
1175969207 20:62675391-62675413 GGCAGCTCCCAAGAGCTGCGGGG + Intronic
1176415954 21:6474926-6474948 GGGAGCTCCCGAGACCGGGGAGG + Intergenic
1176695337 21:9970856-9970878 GGAAGCTTCTGAGAGCTTCCTGG - Intergenic
1177775069 21:25558930-25558952 GGTTCCTCCTGAGAGCTGTGAGG + Intergenic
1178231203 21:30786860-30786882 GAAATCTCCTGAGAGCTTGTTGG + Intergenic
1178413251 21:32383171-32383193 GGAGGCTCCTGGGGGCTGAGTGG - Intronic
1178615031 21:34125069-34125091 GGCAGCTCCAGGGATCTGGGAGG - Intronic
1178698168 21:34811788-34811810 GGGAGCTCCTGAGAGATGGCAGG + Intronic
1178905262 21:36631225-36631247 GGGAGCTGCTGGAAGCTGGGGGG + Intergenic
1178935889 21:36861317-36861339 GGAAGCACCTGAGAGCTTGACGG - Intronic
1179262704 21:39772492-39772514 GGTTCCTCCTGAGGGCTGGGAGG + Intronic
1179303546 21:40134424-40134446 GGAAGCTTCTGCAAGCTGAGGGG + Intronic
1179691454 21:43083260-43083282 GGGAGCTCCCGAGACCGGGGAGG + Intergenic
1179926763 21:44539141-44539163 GGAGGCTCCTGGGAGCAAGGAGG + Exonic
1179987585 21:44930166-44930188 GGAAGCCCCTGAAGGCTGGAGGG + Intronic
1180747670 22:18102225-18102247 AAAAGCACCTGAGAGATGGGAGG + Exonic
1181434260 22:22901011-22901033 TGAAGCTCCTCAGAGGAGGGCGG - Intergenic
1181435196 22:22906377-22906399 TGAAGCTCCTCAGAGGAGGGTGG - Intergenic
1181437601 22:22919570-22919592 TGAAGCTCCTCAGAGGAGGGCGG - Intergenic
1181438246 22:22922629-22922651 TGAAGCTCCTCAGAGGAGGGTGG - Intergenic
1181483703 22:23217800-23217822 GGATGCTCGTGAGACCTGGAGGG + Intronic
1181496386 22:23289509-23289531 AGAAGCTTCTGAAACCTGGGAGG - Exonic
1181823451 22:25494009-25494031 GGAAGCTTCTCAGAGCTCAGGGG - Intergenic
1182664312 22:31945757-31945779 ACAACCTCCTGAGACCTGGGAGG + Intronic
1184386909 22:44181748-44181770 GGAAGCTCCTGCCGGCTGAGCGG + Exonic
1184614137 22:45626400-45626422 GGAAGTTTCTGGGAGCTGCGCGG + Intergenic
1184901392 22:47448629-47448651 GGGAGCTTCTGGGAGGTGGGCGG - Intergenic
1184966223 22:47974070-47974092 GGAAGCTCCAGAGAGAGCGGAGG - Intergenic
1184999962 22:48239313-48239335 GGAAGGCCCTGAGAGCTGAGAGG - Intergenic
1185032098 22:48449558-48449580 GGAAGGTGCTGGGACCTGGGGGG + Intergenic
1185124643 22:49001904-49001926 GGAAGCTGCAGAGAGCTGGAAGG - Intergenic
950223360 3:11213648-11213670 GGAGGCTCCAGAGAGCTGCCTGG - Intronic
950361458 3:12452369-12452391 GGAAGGTCCTTAGTGCTTGGAGG + Intergenic
950654402 3:14427759-14427781 GGCAGCTCCTTGGAGCAGGGTGG - Intronic
951098233 3:18656391-18656413 AGAAGCTCCTGGAAGCTGAGGGG + Intergenic
951514877 3:23547845-23547867 GGGACCTCCTTAGGGCTGGGTGG - Intronic
952620971 3:35342166-35342188 GAATGCTCCTGACAGCTTGGTGG - Intergenic
953636306 3:44668123-44668145 GGTAGCTCCAGAGAGCTGCAAGG - Intergenic
954115932 3:48466794-48466816 GGTGGCCCCTGAGAGGTGGGGGG - Exonic
956884295 3:73543371-73543393 GGCAGCACCTGAGAGGTGAGGGG + Intronic
957022693 3:75142263-75142285 TGCAGCACCTGAGACCTGGGAGG + Intergenic
959637256 3:108589467-108589489 GGAAGCTTCTGAGAGCGAGGGGG - Intronic
960722791 3:120641193-120641215 GGAGGCTCTTGAGAGTTGTGGGG + Intronic
960988673 3:123296468-123296490 GGGAGCTCCCGAGTGATGGGGGG - Intronic
961000311 3:123369801-123369823 GGAAGCAGCTGAGAGCTGTTTGG - Intronic
961056454 3:123793028-123793050 GGGAGCTCCTGAAAGCTTGTAGG - Intronic
961126111 3:124419487-124419509 GAAAGTACCTGAGAGCTTGGGGG - Intronic
961153907 3:124662824-124662846 GGTACCTCCTGAGAGCTGTGAGG + Intronic
961436930 3:126925699-126925721 GGACGCTGCTTAGAGCAGGGAGG + Intronic
961566063 3:127763986-127764008 AGGAGCGCCTGAGAGCCGGGAGG - Intronic
962234753 3:133698470-133698492 GGGTCCTCCTGAGAGCTGTGAGG + Intergenic
963224042 3:142842842-142842864 GGAGGCTCTTGAGAGTTGGTGGG + Intronic
963847995 3:150179463-150179485 GGAAGATCCTGTGGGCTGGCTGG - Intergenic
965519458 3:169658644-169658666 GGAAGCCCCAGTGAGGTGGGAGG - Intronic
966420523 3:179730019-179730041 GGAAGGTCATGAGTGCTGGTAGG + Intronic
966984338 3:185165728-185165750 GGAAGATCCCGAGAGGTAGGAGG - Intergenic
967290530 3:187915304-187915326 GGAGGCTCTTGAGAGCAGGGTGG + Intergenic
968578067 4:1377119-1377141 AGAACCTCCAGAGAGCGGGGGGG + Intronic
968991961 4:3920187-3920209 GGCAGCTTCGGAGAGCTGAGCGG + Intergenic
969131604 4:4994704-4994726 GGTAGGTCCTGAGACCTGAGAGG + Intergenic
969258842 4:6021288-6021310 AACAGCCCCTGAGAGCTGGGGGG + Intergenic
969414839 4:7051418-7051440 GGAAGCTCCTGACAGGTGCGAGG + Intronic
969434934 4:7183547-7183569 GGCAGCTTCTGAAAGCTTGGAGG - Intergenic
969512134 4:7624244-7624266 GTAAGCTCCTCAGAGTTGGGTGG - Intronic
969968705 4:11023717-11023739 AGAAGCTGCAGAGAGCTGTGAGG - Intergenic
971877400 4:32324120-32324142 GGTACCTCCTGGAAGCTGGGAGG - Intergenic
976593671 4:86874344-86874366 AGAAGCTCCTCAGAGCTAGCTGG + Intergenic
977899919 4:102408426-102408448 GGAAACTGCTGAGAAGTGGGAGG - Intronic
977899963 4:102411060-102411082 GGAAACTGCTGAGAAGTGGGAGG - Intronic
979559310 4:122084131-122084153 AGAAGCTCCTGAGTGATAGGAGG + Intergenic
980179184 4:129383368-129383390 GGAAGCTCAGGAGTTCTGGGTGG + Intergenic
980980680 4:139652230-139652252 GGGAGAACCTGAGAGTTGGGAGG + Intergenic
983453930 4:167939401-167939423 GGAAGCCACAGAGAGCTGGCAGG - Intergenic
985126675 4:186701620-186701642 GCAAGTGGCTGAGAGCTGGGTGG - Intronic
985141797 4:186847668-186847690 GGAAGCCCCTGAGGGCAGGCTGG - Intergenic
985366317 4:189236160-189236182 GGAGGCGCCTCAGAGCTGAGAGG - Intergenic
985492559 5:188024-188046 GGGGGCTCCTGAGAGCAGGGCGG - Exonic
985672868 5:1215085-1215107 GGGAGCTCCTGAGGCCTGGGTGG - Intronic
985795376 5:1958192-1958214 CACAGCCCCTGAGAGCTGGGTGG - Intergenic
986026837 5:3859049-3859071 GTAAGCTCATGAAAGCTGAGCGG + Intergenic
986130889 5:4928973-4928995 GTGAGCTCCTGAGTACTGGGTGG - Intergenic
988653830 5:33184706-33184728 GGCAGCTCCTGGGAGCTTGTTGG - Intergenic
990373618 5:55146674-55146696 GGAAGCTTCTGGGAGGTAGGTGG + Exonic
991551705 5:67843802-67843824 GGAATTTCCTGAGAGATAGGAGG - Intergenic
992738917 5:79753296-79753318 GGATGCTTCTGACAGCTGAGTGG - Intronic
995858737 5:116619816-116619838 GGAATCCCATGAGAGCTGCGAGG + Intergenic
996090484 5:119346247-119346269 GGAAGCTGCTGGAGGCTGGGAGG + Intronic
997265958 5:132495790-132495812 GGAACCCCCTGAGAGCGGGGCGG + Intergenic
997529574 5:134573571-134573593 GCAAGGTCCCCAGAGCTGGGAGG + Intronic
998814919 5:146003296-146003318 GGAACCTTCTGGGTGCTGGGAGG + Intronic
1000951115 5:167484489-167484511 GTTGGCTCCTGAGCGCTGGGAGG - Intronic
1004333780 6:14745264-14745286 GGGAACTCCTGAGCGCTGGCTGG - Intergenic
1004470832 6:15927699-15927721 TGAGGTTCCTGAGAGCTTGGGGG + Intergenic
1004633304 6:17442589-17442611 AGAAGTTCCTGAGAGCTGGCTGG + Intronic
1004785413 6:18962796-18962818 GGAAGCTGGTGAGAGATGCGAGG + Intergenic
1007512740 6:42386734-42386756 GGAAGCTCTCTGGAGCTGGGGGG + Intronic
1008376978 6:50802875-50802897 GGAAGCTTCCCAGAACTGGGAGG - Intergenic
1008644205 6:53496515-53496537 TAAAGCTCATGAGAGCTGTGAGG + Intergenic
1010680047 6:78788571-78788593 GGTTCCTCCTGAGAGCTGTGAGG + Intergenic
1012202161 6:96420041-96420063 GGCAGATCCTGAAAGGTGGGTGG - Intergenic
1012611495 6:101225818-101225840 TGCAGCACCTGAGACCTGGGAGG - Intergenic
1013924691 6:115456760-115456782 TGAAGGTCCTGAATGCTGGGAGG - Intergenic
1017751343 6:157492723-157492745 GGTAGGTGCTGAGAGCCGGGAGG + Intronic
1018123591 6:160660392-160660414 GGAAGCCCCTGAGAGAATGGAGG - Intronic
1018629508 6:165810010-165810032 GGATCCTCCTGAGAGCCGGGAGG - Intronic
1018686806 6:166309591-166309613 GAAAGTGCCTGTGAGCTGGGAGG - Intergenic
1018699327 6:166413939-166413961 GGAAGGTCATGAGAGTCGGGGGG + Intronic
1018726383 6:166616150-166616172 TGAAACTCCAGAGTGCTGGGGGG - Intronic
1018999565 6:168737517-168737539 GGAAGCCGCTGTGAGCTTGGAGG + Intergenic
1019235090 6:170605140-170605162 ATAAACTCCTGAGAACTGGGAGG + Intergenic
1019652723 7:2169258-2169280 GGAATCTCCTAAGAGCGGGTAGG + Intronic
1019727514 7:2611271-2611293 GGAAGAGCCTTAGACCTGGGCGG + Exonic
1020314781 7:6897757-6897779 GGCAGCTTCGGAGAGCTGAGCGG + Intergenic
1020467990 7:8502889-8502911 GGAAGCTGCTGGGTGCTAGGTGG + Intronic
1021741641 7:23692189-23692211 GGATCCTTCTGAGAGCTGAGCGG + Intronic
1021849180 7:24791089-24791111 CGCAGCACCTGAGACCTGGGAGG - Intergenic
1022519590 7:30997597-30997619 GTGAGCTCCAGAGAGCAGGGTGG - Intergenic
1023167169 7:37354420-37354442 GGGAGCTGCTGAGAGGTGAGAGG + Intronic
1025983076 7:66423923-66423945 GGAGGCTGACGAGAGCTGGGAGG + Intergenic
1026983256 7:74538679-74538701 GGAACCTCCGGGGAGCTGGGCGG + Exonic
1027214362 7:76174284-76174306 GGAACCTCTGGGGAGCTGGGTGG + Intergenic
1031522785 7:122786880-122786902 GGAAGATGCTTAGGGCTGGGAGG - Intronic
1032068726 7:128791309-128791331 CGGAGCTCCCGAGTGCTGGGAGG + Intronic
1032518846 7:132527333-132527355 AGTAGCTCCTGAGAGGTGGATGG - Intronic
1034235848 7:149568542-149568564 GGAAGCTCCTAGGAGCTGCCAGG - Intergenic
1034240062 7:149603535-149603557 GGAAGCTCCTAGGAGCTGCCAGG - Intergenic
1034747405 7:153535368-153535390 AGAAACTAGTGAGAGCTGGGGGG - Intergenic
1035038069 7:155908301-155908323 AGAGGCTCCAGAGGGCTGGGCGG - Intergenic
1035276497 7:157751077-157751099 GGGAGCTGCTGTGAGCTGTGGGG + Intronic
1035372335 7:158387402-158387424 GCAGGCTCCAGAGAGCTGGAAGG + Intronic
1037521723 8:19686384-19686406 TGTAGCTCCTGAGACCTGGTGGG - Intronic
1037601164 8:20395330-20395352 GGAAGCTCTTGCCAGCTGGCAGG + Intergenic
1037818633 8:22125050-22125072 GGGAGCTCCTGAGGGCTTGGGGG - Intronic
1038127817 8:24693796-24693818 TGAACCTCCTGATATCTGGGTGG + Intergenic
1038635924 8:29287079-29287101 GGAAGAACCTGAGAACTGTGTGG + Intergenic
1039278584 8:35957602-35957624 TGCAGCACCTGAGACCTGGGAGG + Intergenic
1040523310 8:48196345-48196367 GGAAGCAACTCAAAGCTGGGAGG - Intergenic
1040704590 8:50110319-50110341 GGAAGCCCCTGAGAAAAGGGAGG - Intronic
1043771578 8:84208564-84208586 GGAAGGGCCTGGGAGCTGGCAGG + Intronic
1045011680 8:97964150-97964172 GCCAGCTCCTGGGAGCTGGTAGG + Intronic
1046013251 8:108575453-108575475 CGAAGCTCCTCAGGGATGGGTGG + Intergenic
1046134788 8:110011747-110011769 AGAAGCACATGAGATCTGGGAGG + Intergenic
1047049514 8:121095159-121095181 GGAAGCTCCTGATCTTTGGGAGG + Intergenic
1047439176 8:124861306-124861328 GGTTTCTCCTGAGGGCTGGGAGG - Intergenic
1048553800 8:135456990-135457012 GGAAGCTTTAGAGAGCAGGGCGG + Intergenic
1048722314 8:137340017-137340039 CCAAGCTCCTCAGAGCTGGTTGG + Intergenic
1049319895 8:141990694-141990716 GGAAGGGCCTGTGAGGTGGGAGG - Intergenic
1049511150 8:143027203-143027225 GGTGGCTCCTGAGAGCAGGGAGG + Intergenic
1049586687 8:143435675-143435697 GGATGCCCCTGGGGGCTGGGAGG - Intergenic
1049705896 8:144041880-144041902 GGGAGCTACTGTGAGCTGCGTGG + Intronic
1049786621 8:144454014-144454036 GAGACCTCCTCAGAGCTGGGAGG + Intronic
1051970265 9:22879085-22879107 AGAAGCCCCAGAGAGCTGAGTGG + Intergenic
1053590639 9:39511006-39511028 GGAAGCCTCTGAGAACGGGGAGG - Intergenic
1053632318 9:39956806-39956828 GGAAGCTTCTGAGAGCTTCCTGG - Intergenic
1053773442 9:41506724-41506746 GGAAGCTTCTGAGAGCTTCCTGG + Intergenic
1053848499 9:42266395-42266417 GGAAGCCTCTGAGAACAGGGAGG - Intergenic
1054211570 9:62293891-62293913 GGAAGCTTCTGAGAGCTTCCTGG + Intergenic
1054313416 9:63554956-63554978 GGAAGCTTCTGAGAGCTTCCTGG - Intergenic
1054575665 9:66854283-66854305 GGAAGCCTCTGAGAACGGGGAGG + Intergenic
1055937354 9:81615376-81615398 GGAAGTTTCAGAGAGCTGTGTGG + Intronic
1056568422 9:87795353-87795375 ATAAGCTCTTGAGACCTGGGAGG + Intergenic
1056755580 9:89380121-89380143 GGAAGATCCCTTGAGCTGGGGGG - Intronic
1056799091 9:89678968-89678990 GGAAGCTCCTGAGGTGTGGCAGG - Intergenic
1057076855 9:92142410-92142432 GGAAGCTCCTGTGAGCCAGACGG - Intergenic
1057298186 9:93861324-93861346 ACAGGCTCCTGAGTGCTGGGTGG + Intergenic
1057807072 9:98227119-98227141 GGACGCTCCTGAGAGCTGAGAGG - Intronic
1058295499 9:103301335-103301357 GGGAGCCCCTGAGAAATGGGAGG - Intergenic
1058897700 9:109414350-109414372 TGCAGCACCTGAGAGCTGGTCGG - Intronic
1059367253 9:113796429-113796451 GGGAGCTGCTGAGAGGTGGTGGG - Intergenic
1059378899 9:113908091-113908113 GATGGCTCCTGAGAACTGGGAGG + Intronic
1060269557 9:122131107-122131129 GCCAGCTCATGAGAGCTGAGGGG - Intergenic
1060690349 9:125652496-125652518 GGAAGCTGCAGAGAGCATGGGGG - Intronic
1061076525 9:128344778-128344800 GGAAGCTCTGGAGACCTAGGAGG + Intronic
1062343337 9:136103531-136103553 GGCAGCCCCTGAGGGCTGGGGGG + Intergenic
1186102533 X:6172176-6172198 GGAAGATCCTAAGAGCTTGGAGG - Intronic
1186274151 X:7921804-7921826 GCCAGCTCGTGAGCGCTGGGAGG + Exonic
1186486340 X:9936997-9937019 GGAGGCTCCTTCGAGTTGGGTGG + Intronic
1186977647 X:14925201-14925223 GGAAGCTGCAAAGACCTGGGAGG - Intergenic
1187149587 X:16669402-16669424 GGAAACAGCTGAGTGCTGGGGGG + Intronic
1188824147 X:34809518-34809540 GGAAGCTACTGAAAGATTGGTGG - Intergenic
1189218018 X:39344206-39344228 GGGAGCTCCTGAGATCATGGTGG + Intergenic
1189226715 X:39419426-39419448 AGAAGCTCTTAAGAGCTGGCAGG - Intergenic
1190314566 X:49142178-49142200 TGCAGCACCTGAGACCTGGGAGG - Intergenic
1190886459 X:54534742-54534764 AGAGGCTCCTGAGTGCTGGGAGG + Intronic
1192758035 X:74066525-74066547 GGTGGCCCCTGAGAGGTGGGGGG + Intergenic
1192795328 X:74420995-74421017 GGGAGCTCCTGAGGGCAGGGTGG + Intergenic
1194725525 X:97391259-97391281 TGAGCCTTCTGAGAGCTGGGAGG + Intronic
1196118086 X:112018886-112018908 GGAAGCTTCTAGGAGCTGAGAGG - Intronic
1199521603 X:148741795-148741817 GAAAGGTCCTGAGAGCTCGCTGG - Intronic
1200699351 Y:6388949-6388971 TGCAGCACCTGAGACCTGGGAGG + Intergenic
1201034760 Y:9775749-9775771 TGCAGCACCTGAGACCTGGGAGG - Intergenic