ID: 1069898214

View in Genome Browser
Species Human (GRCh38)
Location 10:71691975-71691997
Sequence GGGGGAAGCTCCTGAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 281}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069898214_1069898220 -1 Left 1069898214 10:71691975-71691997 CCCAGCTCTCAGGAGCTTCCCCC 0: 1
1: 0
2: 3
3: 22
4: 281
Right 1069898220 10:71691997-71692019 CACAGTGAGCCCTCATTCCCAGG No data
1069898214_1069898221 0 Left 1069898214 10:71691975-71691997 CCCAGCTCTCAGGAGCTTCCCCC 0: 1
1: 0
2: 3
3: 22
4: 281
Right 1069898221 10:71691998-71692020 ACAGTGAGCCCTCATTCCCAGGG No data
1069898214_1069898227 24 Left 1069898214 10:71691975-71691997 CCCAGCTCTCAGGAGCTTCCCCC 0: 1
1: 0
2: 3
3: 22
4: 281
Right 1069898227 10:71692022-71692044 TCTCAGAGTCATGTCATGAATGG No data
1069898214_1069898222 1 Left 1069898214 10:71691975-71691997 CCCAGCTCTCAGGAGCTTCCCCC 0: 1
1: 0
2: 3
3: 22
4: 281
Right 1069898222 10:71691999-71692021 CAGTGAGCCCTCATTCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069898214 Original CRISPR GGGGGAAGCTCCTGAGAGCT GGG (reversed) Intronic
900205401 1:1429927-1429949 GGGCGAGGCTGCAGAGAGCTAGG - Intergenic
900390186 1:2430470-2430492 GGGGGCAGCAACTGAAAGCTGGG - Intronic
901652553 1:10751650-10751672 TGGGGAAGAGGCTGAGAGCTCGG + Intronic
901655725 1:10768123-10768145 GGGGGAGCCTCCTGAGATCAGGG - Intronic
901776750 1:11565378-11565400 AGGGGAGCTTCCTGAGAGCTGGG + Intergenic
902235521 1:15054908-15054930 GGCGTGGGCTCCTGAGAGCTGGG + Intronic
902408311 1:16198583-16198605 GGGGGAGGCTCCTGTGTGATGGG - Exonic
902454044 1:16518940-16518962 AGGGGCAGCTCCTCAGAGATAGG + Intergenic
902498425 1:16891378-16891400 AGGGGCAGCTCCTCAGAGATAGG - Intronic
902621782 1:17655006-17655028 GGGTGAAGATCCTGAGACCCAGG - Intronic
903190027 1:21651205-21651227 GGAGGAGGTTCCTGAGAGCCAGG + Intronic
904044362 1:27601284-27601306 GGGGAACGTTCCTGAGGGCTTGG + Intronic
904366424 1:30013702-30013724 AGGGGAGGCTCCTGAGTGCTGGG + Intergenic
904532927 1:31181266-31181288 GGGGAAAGCTACTGTGAACTAGG - Exonic
904794435 1:33048680-33048702 GGGAGAAGCTTTTGAGAGCCAGG + Intronic
906603357 1:47148175-47148197 GTGGGAAGCACCTGAGAGTGTGG + Intronic
907333306 1:53685188-53685210 GGGGAGTGCTCCTGTGAGCTGGG - Intronic
909588077 1:77313553-77313575 GAGGGAAGCTGCTGTGAACTGGG - Intronic
911834824 1:102604215-102604237 ATGGGAAGCTACTGAAAGCTAGG + Intergenic
912195743 1:107394992-107395014 TGGGGAAGATTCTGAGGGCTGGG + Intronic
913276670 1:117144952-117144974 GGGGGAGGTCCCTGAGATCTGGG + Exonic
914929904 1:151921751-151921773 AGGGGCAGCTCCTAAGAGATGGG + Intergenic
915914105 1:159930964-159930986 GGGCCAAGGTCCTGAGACCTTGG - Intronic
916075905 1:161199918-161199940 GGGGGAAGCTACTGGGAGCTGGG - Intronic
916786769 1:168092267-168092289 GGGGGCATCTCCTGCCAGCTGGG + Intronic
918083020 1:181221927-181221949 GGAGGAGGCTCCTGAGAGACGGG - Intergenic
918275902 1:182953361-182953383 GGGGGGCGCTGCTCAGAGCTAGG + Exonic
918767056 1:188499896-188499918 AGGGTAGGCTCCTGAGACCTTGG - Intergenic
919716107 1:200778395-200778417 GGGGGAGGCTCCTGAATGCCTGG + Intronic
919801810 1:201358912-201358934 GGGGAAAGCTCCTTAGAGCTTGG + Intergenic
920457886 1:206115003-206115025 AGGGGCAGCTCCTCAGAGATGGG + Intronic
920692731 1:208159170-208159192 GGGGAGGGCTCCTCAGAGCTGGG + Intronic
921887831 1:220324235-220324257 GGAGGAAGCTCCTGAGGAATGGG - Intergenic
922241119 1:223756028-223756050 GGGTGCAGCTGCTCAGAGCTCGG + Intronic
1065636862 10:27743004-27743026 CGGGGCAGCTCCAAAGAGCTTGG - Intronic
1065972840 10:30818721-30818743 GTTGGAAACTCCTGAGAGATGGG + Intergenic
1067077075 10:43194019-43194041 TGGGGGAGCACATGAGAGCTCGG - Intergenic
1067683628 10:48454966-48454988 GGGGATAGCTCCTGGGAGATGGG - Intronic
1069813140 10:71177372-71177394 GGGTCAACCTCCTTAGAGCTAGG - Intergenic
1069898214 10:71691975-71691997 GGGGGAAGCTCCTGAGAGCTGGG - Intronic
1071456993 10:85858512-85858534 GGTGGGGGCTCCTGAGGGCTGGG - Intronic
1073292709 10:102421253-102421275 GGGGGCCGCTCTTGGGAGCTGGG + Intronic
1075364340 10:121870982-121871004 GGAGGAAGTTCATGAGTGCTTGG - Intronic
1075811407 10:125227434-125227456 GGGCCATCCTCCTGAGAGCTGGG - Intergenic
1075871506 10:125774858-125774880 GGAGGCACGTCCTGAGAGCTGGG + Intronic
1077115895 11:884537-884559 AGGGGACGCTCCTGGGAGCCTGG - Intronic
1078196114 11:9138426-9138448 GGGGGAAGCTCTTGAAAGAAAGG - Intergenic
1080655192 11:34252822-34252844 TGGGGGACCTCCTGGGAGCTTGG + Intronic
1081610653 11:44561222-44561244 GGGGGAATCTTCTGAGAGCCTGG + Intergenic
1083878743 11:65538060-65538082 GGAGGTGGCTCCTGGGAGCTTGG - Exonic
1084005879 11:66323282-66323304 TGGGGAGGCTGCTGAGTGCTGGG - Intergenic
1084426437 11:69086832-69086854 GGGGGGTGCTCCTGACATCTGGG + Intronic
1084426449 11:69086868-69086890 GGGGGGTGCTCCTGACATCTGGG + Intronic
1084786909 11:71448026-71448048 CGGGGAAGCTCCAGACAGCGCGG + Intronic
1084874213 11:72118857-72118879 GCGGGCAGCTCCTCAGAGATGGG - Intronic
1084939116 11:72602877-72602899 GCTGGGAGCTCCTGAGAGCAGGG + Intronic
1085789954 11:79488512-79488534 TGGGAAAGCGCCTGGGAGCTGGG - Intergenic
1088770615 11:113032328-113032350 GTGGTAAGCCCCTGAGATCTGGG - Intronic
1088908061 11:114169763-114169785 GGGAGAAGCTCCTAAGAACCAGG + Intronic
1088909336 11:114179061-114179083 GGGGAAAGATCCTCAGAGTTCGG - Intronic
1089645531 11:119876266-119876288 GAGGGAACCTCAAGAGAGCTTGG + Intergenic
1090207097 11:124891422-124891444 GTGGGAGGCGCCTGACAGCTGGG + Exonic
1090975915 11:131679779-131679801 GGGGTGAGCTCCAGAGAGCTGGG + Intronic
1091273572 11:134334243-134334265 AGGGGCTGCTCCTGACAGCTCGG - Intronic
1092793830 12:12091679-12091701 GGGCGAAGCACCTGGGAGATGGG + Intronic
1096498893 12:52053892-52053914 GGGAGCTGCTCCTGGGAGCTGGG + Intronic
1096514201 12:52147340-52147362 TGGGGGAGCTCCTGAGCCCTGGG + Intergenic
1098827010 12:75308971-75308993 AGGGGCAGCTCCTCAGAGATGGG + Intronic
1101054597 12:100899191-100899213 GGGTGAATCTCCTGAGACCAAGG + Intronic
1101659559 12:106753710-106753732 GGGGGTGGTGCCTGAGAGCTTGG - Intronic
1101938453 12:109080093-109080115 GGGGGAAACTCCAGGGAGCCTGG - Intronic
1103250484 12:119495783-119495805 AATGGAAGCTCCTGAGAGCTGGG - Intronic
1106017931 13:25886604-25886626 AGGGGAAGCCTCTGAGAGCGCGG + Intronic
1106386822 13:29294910-29294932 CTGGCCAGCTCCTGAGAGCTGGG - Intronic
1107549158 13:41458507-41458529 CGGGGCAGGTCCTGGGAGCTGGG - Intronic
1109852907 13:68090557-68090579 GAGGTAAGCTACTGAGTGCTTGG - Intergenic
1110362435 13:74642807-74642829 GGGGGAAGCTGCTGGCTGCTGGG - Intergenic
1112847581 13:103663192-103663214 AGGGGATGCTCCTGTGAACTGGG - Intergenic
1113769294 13:112898260-112898282 GGGGGAAGCTGCTGAGGACTGGG - Intronic
1113870455 13:113556347-113556369 GGCGAATGCTCCTGAGACCTGGG + Intergenic
1114430662 14:22657648-22657670 GCAGGAAGCTCCTGGGAGCCTGG + Intergenic
1114577104 14:23725476-23725498 GGTGGCAGCTCCTCAGATCTGGG - Intergenic
1114712577 14:24793469-24793491 AGGGGAAGCTCCTGAGTATTTGG - Intergenic
1115524993 14:34270999-34271021 TGGGGTTGCTCCTGTGAGCTGGG - Intronic
1116870335 14:50063963-50063985 AGGGGCAGCTCCAGAGAGTTAGG - Intergenic
1117324345 14:54655127-54655149 GGGGTAGCCTCCTGTGAGCTTGG - Intronic
1117630418 14:57684844-57684866 TGGGGAAACTCCTGAGAGAGAGG - Intronic
1117840595 14:59856676-59856698 TGGGGAAGCTCAGGAGAGCAAGG - Intronic
1118556032 14:67023543-67023565 TGGGCAAGCTCCTGAGGTCTAGG - Intronic
1118872595 14:69755665-69755687 GGGGGCATCTCATGAGATCTGGG + Intronic
1119207372 14:72804586-72804608 GGGGGAAGGGGCTGAGAGGTTGG + Intronic
1119434364 14:74588106-74588128 GGGAGCAGCTGCTGAGAGGTGGG - Intronic
1119804947 14:77476421-77476443 TGGGAAAGATCCTGAGATCTTGG + Intronic
1120154540 14:81078721-81078743 GTGGGAAGATCCTGAGATCCTGG + Intronic
1121671466 14:95713890-95713912 AGGGGCAGCCCCTGGGAGCTTGG - Intronic
1121798479 14:96754711-96754733 GAGGGAAGCCACTGAGAGGTGGG + Intergenic
1122508231 14:102245789-102245811 GGGGGTATGTCCTGAGAGTTTGG - Intronic
1122537058 14:102472841-102472863 AGGGGCAGCACCTGGGAGCTGGG - Intronic
1122579404 14:102762242-102762264 GTGGGCAGCCCCTGAGGGCTGGG - Intergenic
1123955223 15:25328040-25328062 GGAGGCAACTCCTGAGAGCTGGG - Intergenic
1124103463 15:26716788-26716810 GGGTGGAGGTCCTCAGAGCTGGG - Intronic
1124103471 15:26716819-26716841 GGGTGGAGGTCCTCAGAGCTGGG - Intronic
1124103479 15:26716850-26716872 GGGTGGAGGTCCTCAGAGCTGGG - Intronic
1124103487 15:26716881-26716903 GGGTGGAGGTCCTCAGAGCTGGG - Intronic
1124103504 15:26716943-26716965 GGGTGGAGGTCCTCAGAGCTGGG - Intronic
1124103549 15:26717133-26717155 GGGTGGAGGTCCTCAGAGCTGGG - Intronic
1124292427 15:28465022-28465044 GTGGGAGGATCCTGTGAGCTGGG - Intergenic
1127522615 15:59758127-59758149 GGGGGAGGCTCCTTCGGGCTAGG + Intergenic
1128461699 15:67873746-67873768 GAGGGAAGCTTCTGTCAGCTGGG - Intergenic
1130427091 15:83812254-83812276 GGGGGATGCTCATCAGAACTTGG - Intronic
1130577560 15:85105903-85105925 GAGGAGAGCTTCTGAGAGCTGGG + Intronic
1131230417 15:90654886-90654908 ATAGGAAGCTCCTCAGAGCTGGG - Intergenic
1132507423 16:318462-318484 GAGGGCAGATCCTGAGAGCCAGG - Intronic
1132689705 16:1177017-1177039 GGGGGAAGCTCCTGGGGGGAGGG - Intronic
1132731168 16:1362691-1362713 GGAGGGAGGTCCTGACAGCTTGG + Exonic
1133035227 16:3030597-3030619 TGGGGAAAGGCCTGAGAGCTGGG + Intronic
1133983815 16:10653017-10653039 TGGGGAAGCCCCTCAGAGCTTGG - Intronic
1135646106 16:24163325-24163347 GGAGGAAACTGGTGAGAGCTTGG + Intronic
1135985597 16:27181432-27181454 TGGAGAAGCTCCTGAGAGTCAGG - Intergenic
1136228885 16:28875724-28875746 GGGGGAAGCTTTGGAGAGCCGGG + Intergenic
1138486469 16:57348033-57348055 AGGGGAAGCTCTTCAGAGATGGG + Intergenic
1139928490 16:70505917-70505939 GGGGGAATCACTTGAGATCTGGG + Intronic
1141818928 16:86431925-86431947 AGGTGAAGCTCCTGAAACCTGGG - Intergenic
1142190648 16:88715859-88715881 GGGGGAAGCTGGTGAGTCCTGGG + Intronic
1143336844 17:6178009-6178031 AGGGGCAGCTCCAGATAGCTGGG - Intergenic
1143547326 17:7605457-7605479 TGGGGATGTTCCTGAGAGTTTGG + Intronic
1143551234 17:7631644-7631666 GGGGGCAGATGCTGAGATCTCGG - Exonic
1144573452 17:16415190-16415212 GGGAGAAGGTCCTGGGAGGTGGG + Intergenic
1145097704 17:20045682-20045704 GGAGGAACGTGCTGAGAGCTAGG - Intronic
1145415170 17:22708670-22708692 GGAGGAATGTACTGAGAGCTAGG - Intergenic
1145813025 17:27776110-27776132 GGGAGCAGCTCCTGAGAGGAAGG + Intronic
1145894388 17:28445195-28445217 GCGGGAGGATCCTGTGAGCTAGG + Intergenic
1146660924 17:34664807-34664829 ACGGGAAGCTCTTGAGAACTGGG - Intergenic
1148089346 17:45013542-45013564 GAGGGAAGAGCCTGACAGCTGGG - Intergenic
1151658394 17:75506395-75506417 GCAGGCAGCTCCTGAGAGCTGGG - Exonic
1152311089 17:79550218-79550240 GGGTGATGCCCCTGGGAGCTGGG - Intergenic
1152567387 17:81106387-81106409 GGGGGCAGCTCCTGGGGGCCAGG + Intronic
1152605723 17:81288766-81288788 GGAGGAAGCTCCTCAGGCCTGGG - Intronic
1152609633 17:81309259-81309281 GGGCGGGGCCCCTGAGAGCTGGG + Intergenic
1152627347 17:81393741-81393763 GAGGGGAGCTCCGGAGAGCCCGG - Intergenic
1152694803 17:81738751-81738773 TGGGTCAGCTCCTGGGAGCTTGG - Intergenic
1152739072 17:82011248-82011270 GGGGGAGGCCCCTGTGACCTTGG - Intronic
1152822270 17:82443461-82443483 TGGGGAAGCACCTGACCGCTGGG + Exonic
1152890879 17:82881035-82881057 GTGGGAGGCTTCTGAGGGCTGGG - Intronic
1153555071 18:6303676-6303698 TGGGGAAACTCCTGAGTCCTAGG + Intronic
1153895949 18:9560210-9560232 GGTGGAAGCTGCAGTGAGCTGGG + Intronic
1156794208 18:41022342-41022364 GGGCCAAGATGCTGAGAGCTAGG - Intergenic
1157369964 18:47101812-47101834 GGGGGAAGAGCCTAAGAGCAGGG - Exonic
1157591252 18:48837473-48837495 GGGGGAAGCACCTGAAGGCAGGG + Intronic
1158362654 18:56692970-56692992 GTGGGAAGATCCTTTGAGCTGGG + Intronic
1160018768 18:75164532-75164554 GTGTGCAGCTCCTGAGAGCAGGG + Intergenic
1160429478 18:78801608-78801630 GGGTGAAGCTGCTGAGATGTAGG - Intergenic
1160769499 19:823968-823990 GGGGGACCCTCCTGGCAGCTTGG + Intergenic
1160902337 19:1434710-1434732 GGGAGAAAGTCCTGTGAGCTCGG - Intronic
1163003895 19:14385544-14385566 GGGGGAACCCCCTGAGTGCTGGG + Intronic
1163063410 19:14776074-14776096 AGGGGAACTTCCTGAGTGCTGGG - Intronic
1163227606 19:15975617-15975639 AGGGGCAGCTCCTCAGAGATGGG + Intergenic
1163481242 19:17557668-17557690 GGGGGAAGTTGCAGTGAGCTAGG - Intronic
1165178829 19:33950158-33950180 GGGGGAAGCTTCTGGAAGCCAGG - Intergenic
1165714695 19:38036799-38036821 GGGGGGAGCTCCTGTCAGCCTGG - Intronic
1168614989 19:57830321-57830343 CGGAGAGGCTCCTGAGCGCTAGG + Exonic
1168622278 19:57888988-57889010 AGGAGAGGCTCCTGAGCGCTAGG - Exonic
924998257 2:383951-383973 GGGTAAAGGTCCTGAGTGCTGGG + Intergenic
925993426 2:9271716-9271738 GGGGGAGGCTGCTGAGTCCTCGG + Intronic
926130496 2:10301079-10301101 GGGCTAAGCTGCTGAGGGCTAGG + Intergenic
927199910 2:20571715-20571737 GGGGGAAGCTCTGGTGAGCATGG - Intronic
928128364 2:28631358-28631380 AGGGGAAGCTCCTTAGAGGAGGG - Intronic
929562295 2:42963480-42963502 GGGGGAAGCTTCAGAGAGGGAGG - Intergenic
929764072 2:44829786-44829808 TGGGGAAGCTGCTGAGATGTAGG + Intergenic
930978926 2:57498124-57498146 GAGGAAAGCTCCTGAGACGTGGG - Intergenic
932228695 2:70064268-70064290 GGGGGCAGCACCTGAGGTCTAGG - Intergenic
932408247 2:71528559-71528581 CGGGGCAGTCCCTGAGAGCTGGG - Intronic
932761294 2:74440612-74440634 GGGGGAGGGGCCTGTGAGCTGGG - Intronic
932950581 2:76288487-76288509 GGAGAAGGCTCCTCAGAGCTAGG + Intergenic
934563251 2:95323900-95323922 GGGGCCAGCTCCTGAGGGCAGGG + Intronic
936351929 2:111719516-111719538 GGGGGACGCACCTGAGGGCTGGG + Intergenic
937851731 2:126642235-126642257 GGGGGAGGCAACAGAGAGCTGGG - Intergenic
938077456 2:128347235-128347257 GGGTGAGGCTCCTGTGAACTGGG + Intergenic
938784290 2:134610848-134610870 GGGGGTAGAGCCTCAGAGCTTGG + Intronic
941031500 2:160516860-160516882 GGAGGAAGATGCTGAGAGCTGGG - Intergenic
946405535 2:219490038-219490060 GGGGGGAGGTGCTGAGACCTGGG + Intronic
948596873 2:239085160-239085182 GGCGGCAGCTCCTGAGAGGAAGG - Intronic
948864940 2:240770459-240770481 GGAGGAAGCTGCTGTGACCTGGG + Intronic
1171433247 20:25100216-25100238 GGGGGAGGTCCCTGAGATCTGGG - Intergenic
1173001866 20:39110658-39110680 GGTGGAAGCTCCTGGGGGCCAGG - Intergenic
1175795175 20:61766434-61766456 GGGTGGAGCTCCTAAAAGCTGGG - Intronic
1176375182 21:6083477-6083499 TGGGAGAGCTCCTGAGAGTTAGG + Intergenic
1179018446 21:37616007-37616029 GGAGGGAGCTCCTGTGTGCTGGG + Exonic
1179263695 21:39782857-39782879 GGGGGAAGCTAGGGACAGCTTGG - Intronic
1179449374 21:41458070-41458092 GGGGGAGGCTGCAGTGAGCTGGG - Intronic
1179638282 21:42728929-42728951 GGCGGAGGCTGCAGAGAGCTGGG + Intronic
1179748292 21:43454767-43454789 TGGGAGAGCTCCTGAGAGTTAGG - Intergenic
1179978087 21:44882080-44882102 GAGGGGAGCTCCTGAGACATGGG - Intergenic
1179997667 21:44981425-44981447 AAGGAAAGCTCCTGAGAGCAGGG + Intergenic
1180065109 21:45408546-45408568 GGGAGCAGCTCCTGATTGCTGGG + Intronic
1181234857 22:21442790-21442812 GGGGGGGGCTCCTGAGCGCGTGG - Exonic
1181496387 22:23289512-23289534 GGGAGAAGCTTCTGAAACCTGGG - Exonic
1182443432 22:30377019-30377041 AGAGGAAGCTCCTAAGACCTGGG + Intronic
1183011282 22:34948806-34948828 GGGGGAAGGTCCTGAATACTTGG + Intergenic
1183233305 22:36596671-36596693 GTGGTCAGCTCCTGAGTGCTGGG - Intronic
1183527549 22:38332699-38332721 GGCGGAGGTTCCTGTGAGCTGGG + Intronic
1183931943 22:41240447-41240469 GGGGGAGGCTCCTGGGGGCCGGG - Intronic
1184085323 22:42259115-42259137 GGAGGAAACTCCAGAGAGCATGG - Intronic
1184274827 22:43404300-43404322 GGGGGAGGGTCAGGAGAGCTGGG - Intergenic
1184513471 22:44946263-44946285 AGGGGAAGCTTCTCAGAGATAGG - Intronic
1184677208 22:46050251-46050273 GGCGAAGGCTCCTGAGAGCAGGG + Exonic
1184699065 22:46157396-46157418 GGGGGAAGCTGCAGAGGTCTGGG - Intronic
1184813191 22:46851418-46851440 GGGAGAGGCTCCCCAGAGCTTGG + Intronic
950068062 3:10129356-10129378 GGTGGAAGCTGCAGTGAGCTGGG + Intergenic
950361457 3:12452366-12452388 AGGGGAAGGTCCTTAGTGCTTGG + Intergenic
952577743 3:34795113-34795135 GAGGGAAGCTCCTTTGAGCCAGG - Intergenic
953075273 3:39564370-39564392 GGGGGAAGATCATTAGGGCTGGG + Intergenic
954199279 3:49014588-49014610 GGAGGAGCCTCCTGAGAGCCAGG - Exonic
954752018 3:52819155-52819177 GGGGGCAGCTGCAAAGAGCTGGG + Exonic
955301826 3:57787589-57787611 GCCTGAACCTCCTGAGAGCTGGG + Intronic
958912738 3:100012840-100012862 GGTGGAAGCTGCAGTGAGCTGGG - Intronic
960167487 3:114420216-114420238 TGGGGAAGCCCAGGAGAGCTGGG + Intronic
960823159 3:121755908-121755930 AGGGGAAACTGCTGAGAGGTGGG + Intergenic
960969740 3:123130879-123130901 GGAGGAAGATGCTCAGAGCTAGG - Intronic
961126114 3:124419490-124419512 GTGGAAAGTACCTGAGAGCTTGG - Intronic
961677350 3:128575894-128575916 GCTGGAGGCTCCTGAGAGCAAGG + Exonic
961869306 3:129976255-129976277 TGGGGAAGCTTCTGTGTGCTAGG + Intronic
962583747 3:136820219-136820241 GGGGGTAGGTCCAGAGGGCTGGG + Intronic
962811205 3:138960744-138960766 CAGAGCAGCTCCTGAGAGCTGGG + Intergenic
965776517 3:172237431-172237453 GGGGTGACCTCCTGAGAGCTGGG + Intronic
966478313 3:180375820-180375842 TGGGGAGGCTTCTGAGATCTTGG - Intergenic
967173887 3:186845258-186845280 GGGCAAAGCTCCTGGGAGCTAGG + Intronic
968019739 3:195374537-195374559 GAGAGGAGCTCCTGAGAGTTAGG + Intronic
968518025 4:1022981-1023003 GGGTGGAGCTCCTGGGAGCTGGG + Intronic
968547183 4:1205338-1205360 GGGGGAGGCACCTTTGAGCTGGG + Intronic
968569070 4:1329880-1329902 ACGGGAAGCTCCTGCGGGCTGGG - Intronic
968854888 4:3112390-3112412 GGGAGAGGCTTCTGAGTGCTTGG - Intronic
969176226 4:5400919-5400941 TGGGGAAGCTCAGGAGAGGTCGG + Intronic
969470664 4:7385653-7385675 GGGTGACCCTCCTGAGAGGTGGG + Intronic
969589008 4:8110684-8110706 GAGGGAAGCTGCTAAGAGCATGG + Intronic
971501058 4:27318354-27318376 GGAGGAAGTTCCTGAGATGTGGG + Intergenic
977313280 4:95413306-95413328 GTGGGCATCTCCAGAGAGCTAGG - Intronic
978615167 4:110587186-110587208 GGGGGAAACTGCTGAAAGCTGGG + Intergenic
980374595 4:131928001-131928023 AGGGGAGACACCTGAGAGCTTGG + Intergenic
986741949 5:10712375-10712397 GGGGGAAGCTCCTGTGGGCTGGG + Intronic
992575502 5:78106387-78106409 GGTCGAAGCTGCAGAGAGCTGGG + Intronic
992973533 5:82087634-82087656 AGGGGAAGATTCTGAGAGCAGGG - Intronic
995744986 5:115393835-115393857 GGGGGCAGTTCCTGAAGGCTGGG - Intergenic
997472237 5:134123497-134123519 AGGGGAGGCTCCTGAGAGAGGGG + Intronic
997646354 5:135484714-135484736 GGTGCAGGCTCCAGAGAGCTGGG - Intergenic
999284144 5:150383995-150384017 GGCAGAAGCTTCTGGGAGCTTGG - Intronic
1005220375 6:23580304-23580326 GGGTGAAGAACCTGAGAGGTAGG - Intergenic
1010346931 6:74822198-74822220 GGGGGATGATCCTGAGAGGCTGG + Intergenic
1013618021 6:111862817-111862839 GGGGGAAGCTTTTGAGAGTTGGG + Intronic
1014001526 6:116370937-116370959 GGGCGACGCTACTGAGAGCCGGG - Exonic
1016738561 6:147506869-147506891 TGGCGAAGCTCCTGGGCGCTGGG - Intergenic
1017209072 6:151834953-151834975 GTGAGAAGCTGCTGAGGGCTTGG + Intronic
1017823718 6:158066606-158066628 GTCGGTAGCTCCCGAGAGCTGGG - Exonic
1017926254 6:158913929-158913951 AGGGGCAGCTCCTTAGAGCACGG - Intergenic
1018123592 6:160660395-160660417 GGTGGAAGCCCCTGAGAGAATGG - Intronic
1018136324 6:160781464-160781486 GGGGGAAGCCCCTGAGAAAAGGG + Intergenic
1018315484 6:162552793-162552815 GGTTGAAGGTCCTCAGAGCTTGG - Intronic
1019139000 6:169931376-169931398 TGGGGAAGCTGCTGAGAGTGGGG - Intergenic
1020467989 7:8502886-8502908 TGGGGAAGCTGCTGGGTGCTAGG + Intronic
1021801059 7:24306711-24306733 GGTGGAAGCTCAAGAGAGCAGGG + Intergenic
1022337331 7:29434016-29434038 GAGGGAAGATCCTCAGAGGTTGG - Intronic
1024617851 7:51130614-51130636 CTGGGAAGGCCCTGAGAGCTGGG - Intronic
1029509459 7:100984808-100984830 AGGGGTAGCTCCTCAGTGCTAGG - Intronic
1030268478 7:107645541-107645563 GGGCGAGGCTCCAGTGAGCTAGG + Intergenic
1031193812 7:118588028-118588050 GGGGTGAGCTCCTGAGGCCTTGG + Intergenic
1032015683 7:128379138-128379160 GGGGGCAGCCCCAGAGAGCTGGG - Intergenic
1032346936 7:131125006-131125028 GGGGGATGCTCCCTAGAGCACGG - Intronic
1033995481 7:147340931-147340953 GGTGGCAGCTGATGAGAGCTGGG - Intronic
1034479484 7:151308523-151308545 TGGGGAGGCTGCTGAGTGCTTGG - Intergenic
1034919644 7:155069819-155069841 AAGGGAAGCAACTGAGAGCTGGG + Intronic
1035153443 7:156893372-156893394 TGGGGTAGCCCCTGAGAGCGTGG - Intergenic
1036796191 8:11758239-11758261 TGGAGACGCTCCTGAGGGCTTGG - Intronic
1037818636 8:22125053-22125075 TGGGGGAGCTCCTGAGGGCTTGG - Intronic
1038962394 8:32536322-32536344 GAGGGCAGCGTCTGAGAGCTTGG - Intronic
1039843705 8:41310775-41310797 GGGTTAAGCTCTGGAGAGCTGGG + Intergenic
1040279021 8:46028576-46028598 GGTGGAAGTTCCAGAGACCTGGG + Intergenic
1040358121 8:46639154-46639176 GGTGTAAGCTTCTGTGAGCTTGG - Intergenic
1040569160 8:48592635-48592657 GGGTGACTGTCCTGAGAGCTTGG + Intergenic
1041479332 8:58300379-58300401 GGGGGAAGCACGTGAGAGTTAGG - Intergenic
1041653184 8:60321703-60321725 GGTGGAAGCTGCTCAGAGATGGG - Intergenic
1042212030 8:66390445-66390467 TGATGGAGCTCCTGAGAGCTTGG - Intergenic
1042872501 8:73411356-73411378 TGGGGCAGCACCTGAGGGCTGGG + Intergenic
1045330886 8:101154860-101154882 GGGGGAAGAGGCAGAGAGCTGGG + Intergenic
1046718637 8:117594711-117594733 TGAGGTAGCTCCTGGGAGCTAGG - Intergenic
1048999379 8:139815031-139815053 GGGGGAAGCTGCTAAGAGTCGGG - Intronic
1049059006 8:140261396-140261418 AGGAGAAGCCCCTGAAAGCTGGG + Intronic
1049511149 8:143027200-143027222 GGGGGTGGCTCCTGAGAGCAGGG + Intergenic
1049867622 8:144949193-144949215 GGGGGAAGGTGCTGAGGGATCGG - Intronic
1056525406 9:87438857-87438879 GGTGGAAGCTCTTGAGAACTAGG - Intergenic
1057298163 9:93861235-93861257 GAGGGAGGCTCCGGAGAGCGTGG + Intergenic
1057635036 9:96756763-96756785 GGGGGCAGCCCTTGGGAGCTGGG - Exonic
1058859115 9:109097197-109097219 AGAGGAAGCTCCTGAGAGACTGG + Intronic
1060024375 9:120158479-120158501 GGGGCAAGCTCATTATAGCTAGG - Intergenic
1060557416 9:124515543-124515565 GGGGGAGGTTCCTGAGCTCTGGG + Intergenic
1061497116 9:130981496-130981518 GGGAGAGGCTCCTGCGAGGTGGG - Intergenic
1062115484 9:134805982-134806004 GGGAGGAGCACCTGGGAGCTTGG + Intronic
1062343334 9:136103528-136103550 GGGGGCAGCCCCTGAGGGCTGGG + Intergenic
1062379836 9:136281837-136281859 GGGGGAAGGGCCTGAGGCCTGGG + Intronic
1062446609 9:136597901-136597923 TGGGGAAGCCCCTGAGTGCGGGG + Intergenic
1186102534 X:6172179-6172201 TAGGGAAGATCCTAAGAGCTTGG - Intronic
1187343442 X:18441919-18441941 GGGGCAAGATCCTGAGAGTCAGG - Intronic
1189944076 X:46159233-46159255 GGGGGAAGCTATTGAGAGGGAGG - Intergenic
1190708872 X:53051078-53051100 GGCTGAAGCTCCTGAGATCACGG + Intronic
1197983458 X:132242897-132242919 GGGGAAAGCTAGTGAAAGCTAGG + Intergenic
1198311039 X:135425853-135425875 GGGAGAAGCCTCTGAGGGCTAGG + Intergenic
1198794797 X:140383656-140383678 GAGAGCAGCTCCTAAGAGCTGGG - Intergenic
1199723803 X:150562939-150562961 GGGGGAAGCTTCTGATCCCTGGG + Intergenic