ID: 1069898215

View in Genome Browser
Species Human (GRCh38)
Location 10:71691976-71691998
Sequence TGGGGGAAGCTCCTGAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 528}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069898215_1069898222 0 Left 1069898215 10:71691976-71691998 CCAGCTCTCAGGAGCTTCCCCCA 0: 1
1: 0
2: 4
3: 42
4: 528
Right 1069898222 10:71691999-71692021 CAGTGAGCCCTCATTCCCAGGGG No data
1069898215_1069898227 23 Left 1069898215 10:71691976-71691998 CCAGCTCTCAGGAGCTTCCCCCA 0: 1
1: 0
2: 4
3: 42
4: 528
Right 1069898227 10:71692022-71692044 TCTCAGAGTCATGTCATGAATGG No data
1069898215_1069898221 -1 Left 1069898215 10:71691976-71691998 CCAGCTCTCAGGAGCTTCCCCCA 0: 1
1: 0
2: 4
3: 42
4: 528
Right 1069898221 10:71691998-71692020 ACAGTGAGCCCTCATTCCCAGGG No data
1069898215_1069898220 -2 Left 1069898215 10:71691976-71691998 CCAGCTCTCAGGAGCTTCCCCCA 0: 1
1: 0
2: 4
3: 42
4: 528
Right 1069898220 10:71691997-71692019 CACAGTGAGCCCTCATTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069898215 Original CRISPR TGGGGGAAGCTCCTGAGAGC TGG (reversed) Intronic
900390187 1:2430471-2430493 TGGGGGCAGCAACTGAAAGCTGG - Intronic
900476341 1:2878137-2878159 TGGGGACAGCTCCTGGCAGCCGG + Intergenic
900562376 1:3313668-3313690 TGGCGGAAGCCCCTGGGAGGTGG - Intronic
900909554 1:5585347-5585369 TGGGGCTTGCTCCTGACAGCAGG - Intergenic
900935874 1:5766178-5766200 TGGAAGAACCTCCTGGGAGCTGG - Intergenic
901276910 1:7998920-7998942 TGGGTGGATCTCCTGAGATCAGG + Intergenic
901297178 1:8169596-8169618 TGGGGAAAGCCCATGACAGCTGG - Intergenic
901554190 1:10018668-10018690 TGGGGGAATCACCTGAACGCAGG - Intergenic
901589738 1:10331031-10331053 TGGGTGAATCACCTGAGATCAGG + Intronic
901655726 1:10768124-10768146 TGGGGGAGCCTCCTGAGATCAGG - Intronic
902235520 1:15054907-15054929 TGGCGTGGGCTCCTGAGAGCTGG + Intronic
902408312 1:16198584-16198606 TGGGGGAGGCTCCTGTGTGATGG - Exonic
903851597 1:26310171-26310193 TGGGTGAATCACCTGAGATCAGG + Intronic
903900225 1:26638992-26639014 TGGGAGAATCTCCTGAGCCCAGG + Intergenic
904261692 1:29291314-29291336 TGGGGGAAGCCCCCGAGCTCTGG + Intronic
904366423 1:30013701-30013723 GAGGGGAGGCTCCTGAGTGCTGG + Intergenic
905089275 1:35414953-35414975 TGGGAGAAGCACCTGAGCCCAGG + Intronic
905372102 1:37487974-37487996 TGGGGGAATCACCTGAGCCCGGG - Intergenic
905506656 1:38485255-38485277 TTGGGGAGGCTGCTGAGAGCCGG + Intergenic
905601906 1:39259487-39259509 TGGGTGGATCACCTGAGAGCAGG - Intronic
907333307 1:53685189-53685211 TGGGGAGTGCTCCTGTGAGCTGG - Intronic
907925361 1:58950839-58950861 TGGGGGAATCACCTGAGGTCAGG - Intergenic
908596266 1:65691871-65691893 TGGAGGAAGCTCTGGAAAGCTGG - Intergenic
910425182 1:87114382-87114404 TGGGGGGATCACCTGAGATCAGG + Intronic
912195742 1:107394991-107395013 TTGGGGAAGATTCTGAGGGCTGG + Intronic
914822397 1:151114780-151114802 TGGGTGAATCACCTGAGATCAGG + Intronic
915302255 1:154958453-154958475 TGGAGGAAGATCCGGAGGGCAGG - Exonic
915488061 1:156235865-156235887 TGGGGGTGGCTCCTGACAGAGGG - Intronic
915599608 1:156913982-156914004 TGGGGGGAGATCCTGAGGGAGGG - Exonic
915741693 1:158123543-158123565 TGGGTGGATCTCCTGAGATCAGG + Intergenic
916075906 1:161199919-161199941 TGGGGGAAGCTACTGGGAGCTGG - Intronic
916633077 1:166638009-166638031 TGGGGGGATCTCCTGAGCCCAGG - Intergenic
916786768 1:168092266-168092288 TGGGGGCATCTCCTGCCAGCTGG + Intronic
918083021 1:181221928-181221950 AGGAGGAGGCTCCTGAGAGACGG - Intergenic
918529629 1:185503838-185503860 TGGGAGAATCTCCTGAGCCCAGG + Intergenic
918596510 1:186300209-186300231 TGCGGGTAAGTCCTGAGAGCGGG + Exonic
919720599 1:200829832-200829854 TGGGAGAATCACCTGAGACCAGG + Intronic
919761169 1:201099142-201099164 TGTGGGAAGATGATGAGAGCTGG + Intronic
920560071 1:206932543-206932565 AGGTGGAAGCTCCAGAGCGCTGG - Exonic
920692730 1:208159169-208159191 TGGGGAGGGCTCCTCAGAGCTGG + Intronic
920835398 1:209506181-209506203 TGGGGGCATTTCCTGAGGGCTGG - Intergenic
921066788 1:211628991-211629013 TAGAGGAAGCTCCTGAAAGGAGG - Intergenic
921339281 1:214118354-214118376 TGGGGGAAGCTACTGGAAGTAGG - Intergenic
922000840 1:221476782-221476804 TGGGGGAAGCTCCTGAGATACGG + Intergenic
922706986 1:227795237-227795259 TGGGGGGAGCTCCTGAGGGAAGG - Intergenic
922707014 1:227795299-227795321 TGTGGGGAGCTCCTGAGGGAAGG - Intergenic
922707022 1:227795331-227795353 TGGAGGGAGCTCCTGAGGGAAGG - Intergenic
922832434 1:228610528-228610550 TGGTGGAAGCTCGGGAGCGCGGG - Intergenic
922832994 1:228612769-228612791 TGGTGGAAGCTCGGGAGCGCGGG - Intergenic
922833555 1:228615010-228615032 TGGTGGAAGCTCGGGAGCGCGGG - Intergenic
922834114 1:228617251-228617273 TGGTGGAAGCTCGGGAGCGCGGG - Intergenic
922834672 1:228619492-228619514 TGGTGGAAGCTCGGGAGCGCGGG - Intergenic
922835223 1:228621707-228621729 TGGTGGAAGCTCGGGAGCGCGGG - Intergenic
922835782 1:228623927-228623949 TGGTGGAAGCTCGGGAGCGCGGG - Intergenic
922836341 1:228626169-228626191 TGGTGGAAGCTCGGGAGCGCGGG - Intergenic
922836899 1:228628408-228628430 TGGTGGAAGCTCGGGAGCGCGGG - Intergenic
922837458 1:228630650-228630672 TGGTGGAAGCTCGGGAGCGCGGG - Intergenic
922838019 1:228632891-228632913 TGGTGGAAGCTCGGGAGCGCGGG - Intergenic
922838577 1:228635131-228635153 TGGTGGAAGCTCGGGAGCGCGGG - Intergenic
922839135 1:228637356-228637378 TGGTGGAAGCTCGGGAGCGCGGG - Intergenic
922839695 1:228639597-228639619 TGGTGGAAGCTCGGGAGCGCGGG - Intergenic
922840256 1:228641828-228641850 TGGTGGAAGCTCGGGAGCGCGGG - Intergenic
922840816 1:228644069-228644091 TGGTGGAAGCTCGGGAGCGCGGG - Intergenic
922841379 1:228646300-228646322 TGGTGGAAGCTCGGGAGCGCGGG - Intergenic
923441424 1:234024301-234024323 TGAGGGAAGATGCTGAGAACAGG + Intronic
924232030 1:241970416-241970438 TGGTGGAAACTCCTGAGGTCAGG - Intergenic
924457033 1:244227090-244227112 TGGGAGAAGCTCTTGAGCCCAGG + Intergenic
1063839937 10:10059615-10059637 TCAGGGAATCTCCTGAGAGTAGG - Intergenic
1065367291 10:24949180-24949202 TGGGAGAAGCACCTGAGCCCAGG - Intronic
1066092880 10:32043228-32043250 TGGGCGAATCTCCTGAGGTCAGG - Intronic
1066275739 10:33866564-33866586 TGGGAGAATCACCTGAGACCAGG + Intergenic
1066735332 10:38472017-38472039 TGAAGGAAACTCATGAGAGCTGG - Intergenic
1067683629 10:48454967-48454989 TGGGGATAGCTCCTGGGAGATGG - Intronic
1068326613 10:55497220-55497242 TGGGAGAATCTCTTGAGACCTGG - Intronic
1068689268 10:59899538-59899560 TGGGGGAAGCATCTGAAAACAGG - Intronic
1068706448 10:60081310-60081332 TGGGGGAATCACCTGAGGTCAGG - Intronic
1069449000 10:68501022-68501044 TGGGCGAATCACCTGAGATCAGG + Intronic
1069736459 10:70658360-70658382 TGGGAGAATCTCTTGAGACCGGG + Intergenic
1069769373 10:70887949-70887971 TGGGGGAAGCTCACGGGAGGAGG + Intronic
1069898215 10:71691976-71691998 TGGGGGAAGCTCCTGAGAGCTGG - Intronic
1070033762 10:72702010-72702032 TGGGGGAATCACCTGAGGTCAGG + Intronic
1070341660 10:75503793-75503815 TGGGGGAAGAACCTGAGAGAGGG + Intronic
1071456994 10:85858513-85858535 TGGTGGGGGCTCCTGAGGGCTGG - Intronic
1071850299 10:89561839-89561861 TGGGGGAGGCTCTTGGGAGAAGG + Intergenic
1072159343 10:92752031-92752053 TGGGGGAAGCTAGGGAGAGAGGG - Intergenic
1073042811 10:100618849-100618871 TGGGTGGAGTTCCTGAGAGCAGG - Intergenic
1073137367 10:101227399-101227421 TGGGGGGAGGACCGGAGAGCCGG + Exonic
1073292708 10:102421252-102421274 TGGGGGCCGCTCTTGGGAGCTGG + Intronic
1073496879 10:103899592-103899614 TGGGAGAATCTCCTGAGCCCAGG + Intronic
1074537280 10:114337553-114337575 GGTGGGAAGCTGCTGAGAACTGG - Intronic
1076520197 10:131076489-131076511 TGGGGGGAGCTCTGGAGAGCAGG + Intergenic
1082827854 11:57593923-57593945 TGGGTGAATCACCTGAGATCAGG - Intergenic
1083038300 11:59661175-59661197 TGGGGGAATCACCTGAGCCCGGG - Intronic
1083551542 11:63593805-63593827 TGGGTGAATCACCTGAGATCAGG - Intronic
1083678591 11:64341168-64341190 TGGGGAGAGCACCTGAGAGAGGG - Exonic
1084005880 11:66323283-66323305 TTGGGGAGGCTGCTGAGTGCTGG - Intergenic
1084426436 11:69086831-69086853 TGGGGGGTGCTCCTGACATCTGG + Intronic
1084426448 11:69086867-69086889 TGGGGGGTGCTCCTGACATCTGG + Intronic
1084505890 11:69567863-69567885 TGGTGAAAGTTCTTGAGAGCAGG + Intergenic
1084788588 11:71458731-71458753 AGGAGGGAGCTCCTGAAAGCAGG + Intronic
1084874214 11:72118858-72118880 TGCGGGCAGCTCCTCAGAGATGG - Intronic
1084939115 11:72602876-72602898 TGCTGGGAGCTCCTGAGAGCAGG + Intronic
1085789955 11:79488513-79488535 TTGGGAAAGCGCCTGGGAGCTGG - Intergenic
1085809550 11:79667868-79667890 TGAGGGTAGGTCCTGACAGCTGG - Intergenic
1086329945 11:85743942-85743964 TGAGAGAAGCTCTTAAGAGCTGG - Intronic
1086885455 11:92200378-92200400 TGTGGGAAGCTCCTAGAAGCTGG + Intergenic
1086954974 11:92926230-92926252 TGGAGGAGGGTCCTGATAGCAGG + Intergenic
1087806795 11:102563996-102564018 TGGGTGAACCTACTGAGAGAGGG - Intergenic
1087993200 11:104771251-104771273 TGGGTGAATCACCTGAGATCAGG - Intergenic
1088189970 11:107217543-107217565 TGGGAGGATCTCCTGAGATCAGG + Intergenic
1088444991 11:109916648-109916670 CGTGCAAAGCTCCTGAGAGCAGG + Intergenic
1088595435 11:111437246-111437268 TGCAGGAAGCTTCTGGGAGCAGG - Intronic
1088770616 11:113032329-113032351 TGTGGTAAGCCCCTGAGATCTGG - Intronic
1088850311 11:113698671-113698693 TGGGGCAAGGTCCGGAGACCAGG - Intronic
1089706945 11:120284849-120284871 TGTGGGATGCTGCTGAGAACAGG - Intronic
1090975914 11:131679778-131679800 TGGGGTGAGCTCCAGAGAGCTGG + Intronic
1091788717 12:3258715-3258737 TGGGAGAAGATCTTGGGAGCCGG - Intronic
1092686733 12:11057223-11057245 TGGGAGAATCCCTTGAGAGCAGG - Intronic
1093563978 12:20579651-20579673 TAGGGGAGGGGCCTGAGAGCTGG - Intronic
1094400677 12:30058230-30058252 TGGGGCAAGCTCCTGGGGGGAGG - Intergenic
1094530136 12:31266501-31266523 TGGGCGAATCACCTGAGATCAGG - Intergenic
1094701189 12:32872303-32872325 TGGGTGAAGCACCTGAGGTCAGG + Intronic
1095101368 12:38188422-38188444 TGGGTGAATCACCTGAGATCAGG + Intergenic
1095447199 12:42294159-42294181 TGGGAGGATCTCCTGAGATCAGG + Intronic
1095701443 12:45194958-45194980 TGGGGAAGGAGCCTGAGAGCGGG - Intergenic
1096244525 12:49976692-49976714 TGGGGCAAGCACCTGGGAGGAGG - Exonic
1096514200 12:52147339-52147361 TTGGGGGAGCTCCTGAGCCCTGG + Intergenic
1096518853 12:52173006-52173028 TGGGGGACGCGCCTGGGGGCGGG - Intronic
1096595152 12:52690515-52690537 TGGGGGAAGTTGCTGATTGCAGG - Exonic
1096642976 12:53009294-53009316 TGGGTGAAACACCTGAGAACAGG + Intronic
1097502738 12:60426399-60426421 TGGGAGAAGCTCTTGAGCCCAGG - Intergenic
1099860300 12:88218016-88218038 TGGGGGAGTCTCCTGAGCTCAGG - Intergenic
1100668097 12:96777574-96777596 TGGGTGGATCTCCTGAGATCAGG - Intronic
1101478303 12:105072744-105072766 TGGGCGGATCACCTGAGAGCAGG + Intronic
1102214606 12:111151752-111151774 TCTGGGAGGCTCCTGAGGGCTGG + Intronic
1102243989 12:111343401-111343423 TGGGGGATGTTCCTCAGAGATGG - Intronic
1103250485 12:119495784-119495806 GAATGGAAGCTCCTGAGAGCTGG - Intronic
1103263263 12:119607811-119607833 TGGGAGAATCTCCTGAGCTCAGG - Intronic
1103335515 12:120186519-120186541 TGTAGGAAGAACCTGAGAGCAGG + Intronic
1103520507 12:121534755-121534777 CGGGGGAAGCCCCTGTGATCAGG + Intronic
1104732330 12:131114637-131114659 TGGGGGGAGCCCCTGGGAGGTGG + Intronic
1105297249 13:19098635-19098657 TGGGGGAATCTCTTGAGCGCGGG + Intergenic
1105399468 13:20075921-20075943 TGGGGGGATCACCTGAGATCAGG - Intronic
1105764404 13:23545116-23545138 TGGGGGAAGCTGCTGAGTTTTGG - Intergenic
1106284641 13:28308149-28308171 TGTGGGCAGGTCCCGAGAGCTGG + Intronic
1107300004 13:38955744-38955766 TGGGTGAATCACCTGAGATCAGG - Intergenic
1107523196 13:41203626-41203648 TGGGCGAATCACCTGAGATCAGG - Intergenic
1108070702 13:46625744-46625766 TGGGGGAATCACCTGAGCCCAGG - Intronic
1108187938 13:47907224-47907246 TGGGTGAATCTCCTGAGCTCAGG + Intergenic
1108686304 13:52821788-52821810 TGGGTGAATCACCTGAGATCAGG - Intergenic
1110247418 13:73342297-73342319 TGGGGGAAGGTGCTGGGATCAGG + Intergenic
1110362436 13:74642808-74642830 TGGGGGAAGCTGCTGGCTGCTGG - Intergenic
1111037757 13:82701588-82701610 TGGGTGGATCTCCTGAGATCAGG - Intergenic
1113267803 13:108638866-108638888 TGGGGCAAGCTCATCAGAGTAGG + Intronic
1113427185 13:110218336-110218358 TAGAGGAAGCCCCCGAGAGCTGG - Intronic
1113769295 13:112898261-112898283 TGGGGGAAGCTGCTGAGGACTGG - Intronic
1113870454 13:113556346-113556368 TGGCGAATGCTCCTGAGACCTGG + Intergenic
1114577105 14:23725477-23725499 TGGTGGCAGCTCCTCAGATCTGG - Intergenic
1115895676 14:38084346-38084368 TGGGAGAATTTCCTGAGAGCTGG + Intergenic
1116172921 14:41426428-41426450 TGGGGGCAGATCATGAGATCAGG - Intergenic
1116357122 14:43943006-43943028 TGGGGGAATCACCTGAGGTCAGG - Intergenic
1118217524 14:63823402-63823424 TGGGTGAATCACCTGAGATCAGG - Intergenic
1118806047 14:69237760-69237782 TGCTGGAAGATCCTGAGCGCCGG + Exonic
1118872594 14:69755664-69755686 TGGGGGCATCTCATGAGATCTGG + Intronic
1118911436 14:70065206-70065228 TTGGGGAAGCTCAGGAGGGCAGG - Intronic
1119688880 14:76654948-76654970 TGGGCGAAAGTCCTGAGAGTGGG - Intergenic
1120332609 14:83112640-83112662 TGGGGCAAGAGCCTGAGAGCAGG + Intergenic
1121140917 14:91540855-91540877 TGAGTGAATCTCCTGAGAGCTGG - Intergenic
1121284020 14:92720572-92720594 TGGGAGAATCTCCTGAATGCGGG + Intronic
1121369966 14:93347555-93347577 TGGGGGAGGTTCCTGGGAGAGGG + Intronic
1121692239 14:95886208-95886230 TGGGGGAAGCTCAGGGAAGCTGG - Intergenic
1121798478 14:96754710-96754732 TGAGGGAAGCCACTGAGAGGTGG + Intergenic
1122046545 14:99028098-99028120 TGGGGGAATCTCCCGAGCTCTGG - Intergenic
1122221872 14:100244508-100244530 TGGGTGAATCACCTGAGATCAGG - Intronic
1122352221 14:101102883-101102905 TCGGGGCAGCTCCAGAGAGGAGG + Intergenic
1122597620 14:102904082-102904104 TGGTGGGAGCTCCTGGGAGCAGG - Intronic
1123055751 14:105568854-105568876 TGGGGGTGGCCCCTGAGAGTCGG - Intergenic
1123067740 14:105626922-105626944 CGGGGGAAGCTCTGGAGAGAGGG - Intergenic
1123071759 14:105645647-105645669 CGGGGGAAGCTCTGGAGAGAGGG - Intergenic
1123080108 14:105688373-105688395 TGGGGGTGGCCCCTGAGAGTCGG - Intergenic
1123080156 14:105688627-105688649 TGGGGGTGGCCCCTGAGAGTCGG - Intergenic
1123091423 14:105743923-105743945 CGGGGGAAGCTCTGGAGAGAGGG - Intergenic
1123097193 14:105772264-105772286 CGGGGGAAGCTCTGGAGAGAGGG - Intergenic
1123142566 14:106095099-106095121 TGGGGGAAGCTCAGGACACCAGG - Intergenic
1202911368 14_GL000194v1_random:120286-120308 GGTGGGCAGATCCTGAGAGCAGG - Intergenic
1123442173 15:20300785-20300807 TGGGGGGAGCTATTGAGGGCAGG + Intergenic
1123955224 15:25328041-25328063 AGGAGGCAACTCCTGAGAGCTGG - Intergenic
1124103464 15:26716789-26716811 TGGGTGGAGGTCCTCAGAGCTGG - Intronic
1124103472 15:26716820-26716842 TGGGTGGAGGTCCTCAGAGCTGG - Intronic
1124103480 15:26716851-26716873 TGGGTGGAGGTCCTCAGAGCTGG - Intronic
1124103488 15:26716882-26716904 TGGGTGGAGGTCCTCAGAGCTGG - Intronic
1124103505 15:26716944-26716966 TGGGTGGAGGTCCTCAGAGCTGG - Intronic
1124103550 15:26717134-26717156 TGGGTGGAGGTCCTCAGAGCTGG - Intronic
1125479104 15:40068379-40068401 TGGGGGAATCACCTGAGCCCAGG + Intergenic
1125725960 15:41868285-41868307 TGAGGGAAGCTCCTGAGGAGAGG + Intronic
1128461700 15:67873747-67873769 TGAGGGAAGCTTCTGTCAGCTGG - Intergenic
1129382833 15:75178635-75178657 TGGGGGCCGCTCCTGCAAGCCGG + Intergenic
1129836941 15:78714593-78714615 AAGGGGCAGCTCCAGAGAGCAGG + Intronic
1130510265 15:84583262-84583284 AAGGGGCAGCTCCAGAGAGCAGG - Intergenic
1130577559 15:85105902-85105924 TGAGGAGAGCTTCTGAGAGCTGG + Intronic
1130857435 15:87853271-87853293 TGGGGGAAGCTGGGGAGAGATGG + Intergenic
1132051904 15:98614392-98614414 AAGGGGAAGCTTCTGAGGGCTGG + Intergenic
1132247906 15:100311402-100311424 TCAGGGAAGCTCCTGGCAGCTGG - Intronic
1132247971 15:100311979-100312001 TCAGGGAAGCTCCTGGCAGCTGG + Intronic
1132629560 16:910611-910633 TGGGGGAAGCTCAGGAGGGCTGG + Intronic
1132689706 16:1177018-1177040 TGGGGGAAGCTCCTGGGGGGAGG - Intronic
1132791537 16:1692191-1692213 TGGGGGAAGCTCTTCTGTGCTGG + Intronic
1133099684 16:3471613-3471635 AGGGAGAACCACCTGAGAGCTGG - Intronic
1133789771 16:9000581-9000603 TGGGCGAATCACCTGAGATCAGG - Intergenic
1133890288 16:9872800-9872822 TGGGGGAATCACCTGAGCTCAGG + Intronic
1134129185 16:11637116-11637138 TGGGCGAATCACCTGAGATCAGG - Intergenic
1135344231 16:21674559-21674581 TGGGTGAATCACCTGAGATCAGG - Intergenic
1136228884 16:28875723-28875745 TGGGGGAAGCTTTGGAGAGCCGG + Intergenic
1137337224 16:47562002-47562024 TGAGAGAAGCTCCAAAGAGCTGG + Intronic
1137646500 16:50079797-50079819 TGGAGGAAGTTCCTGAAGGCTGG - Intronic
1138208653 16:55144299-55144321 TGGAGGAGGGTCCTTAGAGCTGG + Intergenic
1138430795 16:56967426-56967448 TGGGGGAATCACCTGAGGTCAGG + Intronic
1138573715 16:57892849-57892871 TTGGGGAAGCTGCTCTGAGCAGG - Intronic
1139533737 16:67558515-67558537 TGGGCGGATCTCCTGAGATCAGG + Intergenic
1139645468 16:68326471-68326493 TGGGGGGATCCCCTGAGATCAGG - Intronic
1140073899 16:71678545-71678567 TGGGAGAATCGCCTGAGAACGGG + Intronic
1140915499 16:79489574-79489596 TCAGGGAAGCTCCTTAGAGGAGG + Intergenic
1141002896 16:80324750-80324772 TGGCTGAAGGTCCTGAGGGCAGG + Intergenic
1141097819 16:81175340-81175362 AGGGGGAGGGTCCTGGGAGCTGG - Intergenic
1141516042 16:84545708-84545730 TGGGTGAATCTCCTGAGGTCAGG + Intronic
1141658205 16:85427412-85427434 TGGGTGGAGCACCTGAGACCAGG + Intergenic
1142372741 16:89692049-89692071 TGGGGGCATCTGCTGGGAGCGGG + Intronic
1142690758 17:1605105-1605127 TGTGGGAAGCACCTGAGGGCGGG - Intronic
1143785199 17:9250480-9250502 TGGGGGAATTTATTGAGAGCAGG + Exonic
1143967835 17:10769601-10769623 TGGGAGAAGCACCTGAGACCAGG - Intergenic
1144201080 17:12943341-12943363 TAGGGGGAGCTCTTCAGAGCTGG - Intronic
1144573201 17:16413484-16413506 TGGGCGGAGCTCCTGAGGTCGGG + Intergenic
1144573451 17:16415189-16415211 TGGGAGAAGGTCCTGGGAGGTGG + Intergenic
1144700006 17:17331187-17331209 CAGGGGAAGCTCCTGAATGCTGG - Intronic
1144871640 17:18375749-18375771 TGGGCGAATCTCCTGAGGTCAGG + Intergenic
1145828687 17:27897506-27897528 TGGGTGGATCTCCTGAGATCAGG + Intergenic
1145955537 17:28851957-28851979 TGGGGGAATCACCTGAGCCCAGG + Intronic
1146294658 17:31640272-31640294 TGGGTGAATCTCCTGAGGTCAGG - Intergenic
1146359945 17:32165955-32165977 TGGGCGGATCTCCTGAGACCAGG + Intronic
1146971322 17:37074702-37074724 TGGGGGAATCACCTGAGGTCAGG - Intergenic
1147443199 17:40459982-40460004 TTGGGGAATCTCTGGAGAGCTGG + Intergenic
1147844857 17:43398032-43398054 TGGGCGAAGCACCTGAGGTCAGG - Intergenic
1148090638 17:45020797-45020819 TGGGGGAGGCTCCTAGGGGCAGG - Intergenic
1148336577 17:46846016-46846038 TGGGTGGAGCACCTGAGATCAGG - Intronic
1149039161 17:52167130-52167152 TGGGAGAAGCTCCTGGGCTCAGG - Intergenic
1149598443 17:57877657-57877679 TGGGCGAATCACCTGAGATCAGG + Intronic
1149629602 17:58111439-58111461 TGGGCGAATCACCTGAGATCAGG - Intergenic
1150243326 17:63653957-63653979 TGGGGGAATCGCTTGAGCGCAGG - Intronic
1150483050 17:65525194-65525216 TGGGGGAATCACCTGAGGTCAGG + Intergenic
1151268864 17:72977914-72977936 TGGGAGAGGCTCCTGGGAACAGG - Intronic
1151349175 17:73521564-73521586 TGGGAGAAGCTCCTGAGTACAGG - Intronic
1151413637 17:73947530-73947552 GGTGGGAGGCTCATGAGAGCAGG + Intergenic
1151658395 17:75506396-75506418 TGCAGGCAGCTCCTGAGAGCTGG - Exonic
1151932948 17:77244276-77244298 TGGGAGAATCTCCTGAGCTCAGG + Intergenic
1152495355 17:80667259-80667281 CGGGGGAAGCTCCATAGAGGTGG + Intronic
1152605724 17:81288767-81288789 TGGAGGAAGCTCCTCAGGCCTGG - Intronic
1152822269 17:82443460-82443482 TTGGGGAAGCACCTGACCGCTGG + Exonic
1153136588 18:1924522-1924544 TGGGTGAAGCACCTGAGGTCAGG - Intergenic
1153170670 18:2312386-2312408 TGGGAGAATCACCTGAGACCAGG + Intergenic
1155408363 18:25514292-25514314 TGGGTGAATCACCTGAGATCAGG - Intergenic
1155834056 18:30556322-30556344 TGGGTGGATCTCCTGAGATCAGG + Intergenic
1156181541 18:34611382-34611404 TGGAGGAAACTTCTGAGACCAGG - Intronic
1156413005 18:36853883-36853905 TGGGTGAATCACCTGAGATCAGG - Intronic
1156607726 18:38687985-38688007 TGGGAAAATCACCTGAGAGCAGG - Intergenic
1156826113 18:41431853-41431875 TGGGAGAATCACCTGAGATCAGG + Intergenic
1157185530 18:45537203-45537225 TGTAAGCAGCTCCTGAGAGCAGG - Intronic
1157369965 18:47101813-47101835 AGGGGGAAGAGCCTAAGAGCAGG - Exonic
1157591251 18:48837472-48837494 TGGGGGAAGCACCTGAAGGCAGG + Intronic
1157747719 18:50151025-50151047 AGAGGAAGGCTCCTGAGAGCTGG - Intronic
1159894174 18:73980816-73980838 TGAGGGCAGCTCCTGTGAGTGGG - Intergenic
1160018767 18:75164531-75164553 GGTGTGCAGCTCCTGAGAGCAGG + Intergenic
1160245265 18:77153619-77153641 TGGAGGAAGCCCCGGAGGGCTGG + Intergenic
1160370439 18:78368503-78368525 TGTGGGAGGCTCCGGAAAGCTGG + Intergenic
1160470550 18:79128929-79128951 TGGGAGAAGGTGCTGAGATCAGG - Intronic
1160735055 19:658606-658628 TGGTGGCAGCTGCTGAGGGCGGG - Intronic
1160983354 19:1826749-1826771 TGGAGGCAGCTCCTCAGTGCTGG - Intronic
1161123116 19:2540981-2541003 CGGTGGAGGCTTCTGAGAGCTGG + Intronic
1161778442 19:6276590-6276612 TTGGGAAAGGGCCTGAGAGCAGG - Intronic
1162475630 19:10897758-10897780 TGGGTGAATCACCTGAGATCAGG + Intronic
1163003894 19:14385543-14385565 AGGGGGAACCCCCTGAGTGCTGG + Intronic
1163731246 19:18950603-18950625 TGGGTGAATCACCTGAGATCAGG + Intergenic
1164050827 19:21584953-21584975 TGGGCGGATCTCCTGAGATCAGG + Intergenic
1164852244 19:31493689-31493711 TGGGGGAATCACCTGAGATCAGG - Intergenic
1165244832 19:34492951-34492973 TGGAGGAGGGTGCTGAGAGCTGG + Intronic
1165432073 19:35778552-35778574 CGGGGGAAGCTCCGGAAGGCAGG - Exonic
1165454288 19:35901786-35901808 TGGGGGGATCACCTGAGATCAGG - Intronic
1165595192 19:37007159-37007181 TGGGCGGATCACCTGAGAGCAGG - Intergenic
1166086063 19:40475951-40475973 TGGGAGAATCTCCTGAGCCCGGG + Intronic
1166167182 19:40999779-40999801 TGGGAGAATCTCCTGAGCACAGG - Intronic
1166271350 19:41716157-41716179 TGGAGGAAGCTTCACAGAGCGGG + Intronic
1167070530 19:47219601-47219623 TGGGCGAATCACCTGAGATCAGG - Intergenic
1167394807 19:49221364-49221386 TGGGAGAATCTCCTGAGCCCAGG - Intergenic
1167635128 19:50649823-50649845 TGGGGGAAGATGCTGAGCTCAGG - Intronic
1167829676 19:52008961-52008983 TGGGCGGATCACCTGAGAGCGGG + Intergenic
1167894090 19:52567177-52567199 TGGGGGCATCACCTGAGATCAGG - Intronic
1168107508 19:54173666-54173688 TGGGGGCAGGTCCTGGGAGTGGG - Exonic
1168361962 19:55748924-55748946 TGGGTGAATCACCTGAGATCAGG + Intergenic
924998256 2:383950-383972 TGGGTAAAGGTCCTGAGTGCTGG + Intergenic
926462212 2:13145083-13145105 GGAGGGAAGGTCCTGAGAGCTGG - Intergenic
926956371 2:18305766-18305788 TAGGGGAAGCTTCTCAGAGGAGG + Intronic
927980696 2:27373166-27373188 CGGGGGAACCTACTGAGAGGAGG + Intronic
928128365 2:28631359-28631381 CAGGGGAAGCTCCTTAGAGGAGG - Intronic
928141696 2:28734935-28734957 TGGGCGAATCTCCTGAGGTCAGG + Intergenic
928233606 2:29521297-29521319 TAGGGGAGGCCACTGAGAGCAGG - Intronic
928343098 2:30462566-30462588 TGGGGGAAACTTCTGAAACCAGG + Intronic
930317144 2:49811447-49811469 TGGGTGAAGCACCTGAGGTCAGG - Intergenic
931729501 2:65140565-65140587 TGGGGGAATCACCTGAGGCCAGG + Intergenic
932248839 2:70221878-70221900 TGGGGGAATCACCTGAGCCCAGG - Intronic
932792903 2:74671402-74671424 TGGGGGAAGCAGCAGAGAGTGGG - Intronic
934158395 2:89225052-89225074 TGCCGGTAGTTCCTGAGAGCAGG + Intergenic
934563250 2:95323899-95323921 AGGGGCCAGCTCCTGAGGGCAGG + Intronic
935684266 2:105669776-105669798 TTGGGGAAGCTCCAGGCAGCTGG + Intergenic
936351928 2:111719515-111719537 CGGGGGACGCACCTGAGGGCTGG + Intergenic
936737991 2:115469669-115469691 TGGGTGGATCACCTGAGAGCGGG + Intronic
937231767 2:120401951-120401973 TGTGGGACACTCCAGAGAGCAGG + Intergenic
937796026 2:126021226-126021248 TGGGGGGATCTCCTGAGGTCAGG - Intergenic
937915780 2:127098042-127098064 GGCTGGGAGCTCCTGAGAGCAGG + Intronic
938542453 2:132295695-132295717 TGGGTGGATCTCCTGAGATCAGG + Intergenic
938851250 2:135262686-135262708 TGGGAGAATCTCCTGAGTCCAGG + Intronic
938978215 2:136500044-136500066 TGGGAGAATCACCTGAGACCAGG + Intergenic
939274446 2:139982813-139982835 TATGGTAACCTCCTGAGAGCAGG + Intergenic
939605328 2:144247764-144247786 TGGGAGAATCTCCTGAGCCCGGG - Intronic
940055895 2:149512203-149512225 TGGGTGAATCACCTGAGATCAGG + Intergenic
941031501 2:160516861-160516883 AGGAGGAAGATGCTGAGAGCTGG - Intergenic
942042458 2:172080012-172080034 TGGGGGAAGCACTTGAGGGGAGG + Intronic
942286621 2:174424016-174424038 TGGGAGAATCTCTTGAGACCAGG - Intronic
942736029 2:179113966-179113988 TGGGGGGAGCTTCTGGGTGCTGG + Intronic
943042463 2:182820024-182820046 TGGGAGAAGCTCCTTAGGGTCGG + Intergenic
946101007 2:217323090-217323112 TGGGGGAATCACCTGAGCCCAGG - Intronic
946259326 2:218472691-218472713 TGGGTGAATCACCTGAGATCAGG - Intronic
946405534 2:219490037-219490059 TGGGGGGAGGTGCTGAGACCTGG + Intronic
947364304 2:229378419-229378441 TGGGTGAAGGTCCTGAAGGCAGG + Intronic
947444744 2:230155337-230155359 TGGGGGAAACTCCTGTGGACGGG - Intergenic
947645681 2:231737722-231737744 TGGAGGAAGCTGCTATGAGCAGG - Intronic
947834738 2:233167141-233167163 TGGGAGGACCTCCTGAGACCGGG + Intronic
1169945149 20:10980025-10980047 TGGGCGAATCACCTGAGATCAGG - Intergenic
1171823070 20:29873708-29873730 TGGTGGAAGCTCCAGAGCTCGGG + Intergenic
1171871332 20:30528541-30528563 TGGGTGGATCTCCTGAGATCAGG + Intergenic
1171897032 20:30816603-30816625 TGGTGGAAGCTCCAGAGCTCGGG - Intergenic
1172777516 20:37416115-37416137 TGGGGGAACTCCCTGAGTGCAGG + Intergenic
1173657875 20:44713403-44713425 TGGGAGAACCACCTGAGATCAGG - Intergenic
1173727238 20:45306674-45306696 TGGCGGTCGCTCCTGAGAGCAGG - Intronic
1173801264 20:45895965-45895987 TGGGGGAATCACCTGAGGTCAGG + Intronic
1174127570 20:48318279-48318301 GGAGGGAAGCTTCTGCGAGCTGG + Intergenic
1176110337 20:63407982-63408004 TGGGGCCTGCTTCTGAGAGCCGG - Intronic
1177435975 21:21052390-21052412 TGGGTGAATCACCTGAGATCAGG - Intronic
1178556006 21:33590641-33590663 TGGGTGAATCACCTGAGATCAGG - Intronic
1178598004 21:33972439-33972461 TGGGGGAATCACCTGAGGTCAGG - Intergenic
1178698167 21:34811784-34811806 TGATGGGAGCTCCTGAGAGATGG + Intronic
1178905344 21:36631870-36631892 TGGGGGAATCACCTGAGCCCGGG - Intergenic
1179713307 21:43275180-43275202 TGGGGGAAGCTCTGGACATCGGG + Intergenic
1179793412 21:43768545-43768567 GGGGGTGAGCCCCTGAGAGCCGG - Intergenic
1179799793 21:43805885-43805907 TGGGAGAAGCGCCTGAGCCCAGG + Intergenic
1179930426 21:44567889-44567911 GGGGGGCGGCTACTGAGAGCTGG + Exonic
1179978088 21:44882081-44882103 TGAGGGGAGCTCCTGAGACATGG - Intergenic
1179997666 21:44981424-44981446 GAAGGAAAGCTCCTGAGAGCAGG + Intergenic
1180051299 21:45332112-45332134 AGGGGGAAGGGGCTGAGAGCAGG + Intergenic
1180051308 21:45332136-45332158 AGGGGGAAGGGGCTGAGAGCGGG + Intergenic
1180065108 21:45408545-45408567 TGGGAGCAGCTCCTGATTGCTGG + Intronic
1180138307 21:45875579-45875601 TGGGGGAAGCTGGTGTGGGCAGG - Intronic
1180210260 21:46291575-46291597 TGGGGGAAGAACCTGTAAGCAGG + Intronic
1181015501 22:20066305-20066327 GGGATGAAGCTCCTTAGAGCTGG - Intergenic
1181483701 22:23217796-23217818 TGTGGGATGCTCGTGAGACCTGG + Intronic
1181487330 22:23239564-23239586 TGTGGGCAGCTCCTCAGTGCTGG + Intronic
1181793375 22:25284881-25284903 TGGGTGAATCACCTGAGATCGGG - Intergenic
1182496263 22:30710111-30710133 TGGGGGAATCACCTGAGGTCAGG - Intronic
1182567088 22:31208225-31208247 TGGGAGAACCTACTGAGACCGGG - Intergenic
1182650804 22:31849551-31849573 TGGGTGAATCACCTGAGACCAGG + Intronic
1183233306 22:36596672-36596694 TGTGGTCAGCTCCTGAGTGCTGG - Intronic
1183931944 22:41240448-41240470 AGGGGGAGGCTCCTGGGGGCCGG - Intronic
1184099183 22:42332897-42332919 TGGGGGCAGCTGCTGGCAGCAGG + Intronic
1184588326 22:45462803-45462825 TGGGTGGATCTCCTGAGATCAGG - Intergenic
1184677207 22:46050250-46050272 TGGCGAAGGCTCCTGAGAGCAGG + Exonic
1184699066 22:46157397-46157419 TGGGGGAAGCTGCAGAGGTCTGG - Intronic
949285325 3:2396115-2396137 TGGGAGAAGCACCTGAGCTCGGG - Intronic
949925311 3:9036616-9036638 TGAGGGAAGACCCTGAGACCTGG + Intronic
950471737 3:13190461-13190483 TGGGAGAATCTCCTGAGCCCAGG + Intergenic
950639574 3:14340092-14340114 TGGGTGCAGCTACTGAGGGCCGG + Intergenic
951189338 3:19749859-19749881 TGTGGGAAGCTCCTGACGGTGGG - Intergenic
951226686 3:20128778-20128800 TGGGTGGATCTCCTGAGATCAGG + Intronic
951318272 3:21213643-21213665 TGGGTGAATCACCTGAGATCAGG + Intergenic
953075272 3:39564369-39564391 TGGGGGAAGATCATTAGGGCTGG + Intergenic
953607915 3:44423994-44424016 TGGAGGGAGCTTCAGAGAGCAGG + Intergenic
954057773 3:48041962-48041984 TCTGGAAAGGTCCTGAGAGCAGG - Intronic
954076310 3:48183988-48184010 TTGGGGGTGCTCCTGAGAACAGG - Intronic
954301808 3:49704297-49704319 TGGGGGAGGCCCTGGAGAGCAGG + Intronic
955301825 3:57787588-57787610 TGCCTGAACCTCCTGAGAGCTGG + Intronic
955936483 3:64107612-64107634 TGGGAGGAGCTCCTGAGCCCAGG + Intronic
956179565 3:66504429-66504451 TGGGGGGATCACCTGAGATCAGG + Intergenic
956746335 3:72313843-72313865 GGCCGTAAGCTCCTGAGAGCTGG - Intergenic
959187217 3:103059590-103059612 TGTAGGCAGCCCCTGAGAGCTGG - Intergenic
960419354 3:117424987-117425009 AGGGAGAAGATCCTGAAAGCAGG - Intergenic
960823158 3:121755907-121755929 TAGGGGAAACTGCTGAGAGGTGG + Intergenic
961163446 3:124748716-124748738 TGGGGGGAGCCCAGGAGAGCAGG + Intergenic
962583746 3:136820218-136820240 TGGGGGTAGGTCCAGAGGGCTGG + Intronic
963217571 3:142766606-142766628 TGGGTGAATCACCTGAGATCAGG - Intronic
965685606 3:171299064-171299086 TGTGGGGAGCTCCTGTGAGGCGG + Intronic
965776516 3:172237430-172237452 TGGGGTGACCTCCTGAGAGCTGG + Intronic
966648676 3:182274557-182274579 TGGGGGAAACTCCTCTGATCGGG + Intergenic
967946219 3:194806247-194806269 TGGGGAAAGATCCAGAGAGGAGG - Intergenic
968518024 4:1022980-1023002 CGGGTGGAGCTCCTGGGAGCTGG + Intronic
968672091 4:1857158-1857180 GGGGGGAGGCTCCTGGGAGACGG - Intergenic
968952200 4:3701029-3701051 TGGGGGAGGCACTTGTGAGCAGG + Intergenic
969438455 4:7202096-7202118 TGTGGGAACCTGCTGGGAGCGGG - Intronic
969462081 4:7334251-7334273 TGCGGGAAGGGGCTGAGAGCAGG - Intronic
969731922 4:8962616-8962638 TGGGGGTATCACCTGAGATCTGG + Intergenic
969791519 4:9496701-9496723 TGGGGGTATCACCTGAGATCTGG + Intergenic
970119870 4:12741643-12741665 TGGGCGAATCACCTGAGATCAGG - Intergenic
970216759 4:13766995-13767017 TGAGGGCAGGTGCTGAGAGCAGG + Intergenic
971109034 4:23561929-23561951 TGGGGGAATCACCTGAGGTCAGG - Intergenic
971143403 4:23949422-23949444 TGGGGGATGTTGCTGAAAGCTGG - Intergenic
971463974 4:26934684-26934706 TGGGTGAATCTCCTGAGGTCAGG + Intronic
972660761 4:41113859-41113881 TGGGTGCATCTCCTGAGATCAGG + Intronic
973653510 4:53021639-53021661 TGGGAAAAGCTCCTTAGAGAAGG + Intronic
975342951 4:73261438-73261460 TGGGGGAATCACCTGAGGTCGGG - Intergenic
975704312 4:77096981-77097003 TGGGTGAATCACCTGAGATCAGG + Intergenic
976086266 4:81410161-81410183 TGGGGGTATCTCCTGAGCCCAGG - Intergenic
976543499 4:86305589-86305611 TGGGGGAATCACCTGAGGTCAGG + Intronic
976729013 4:88244209-88244231 TGGGGGCGGGTGCTGAGAGCGGG - Intergenic
976973201 4:91134136-91134158 TGGGTGAAGATTCTGAAAGCTGG - Intronic
977535239 4:98249749-98249771 TGGGTGAGGATCCTGAGAGAAGG - Intergenic
977599490 4:98920520-98920542 TGGGCGAATCACCTGAGATCAGG - Intronic
977612764 4:99053340-99053362 TGGGGGAATCACCTGAGCCCAGG - Intronic
978615166 4:110587185-110587207 GGGGGGAAACTGCTGAAAGCTGG + Intergenic
982425061 4:155248421-155248443 TGGGGGAAGCAGCAGTGAGCAGG + Intergenic
983997169 4:174196734-174196756 CGGGGGAAGCACTTGAGCGCAGG - Intergenic
984472323 4:180192218-180192240 TGGGTGAATCACCTGAGATCGGG - Intergenic
985553165 5:543396-543418 TGGGGAAAGCCGCTGAGGGCCGG + Intergenic
986741948 5:10712374-10712396 TGGGGGAAGCTCCTGTGGGCTGG + Intronic
987182492 5:15382767-15382789 TGGGAGAAGCTATTGAGAGGGGG - Intergenic
987409743 5:17603160-17603182 TGGGTGGATCTCCTGAGATCAGG - Intergenic
990962918 5:61413911-61413933 TGAAGGAAGCTCCTGAGGGCAGG + Intronic
991614591 5:68482797-68482819 AGGGAGAAGCTCCTGAGGGAAGG + Intergenic
992755525 5:79902073-79902095 TGGGGGAATCTCCTGAGCCCAGG + Intergenic
992973534 5:82087635-82087657 TAGGGGAAGATTCTGAGAGCAGG - Intronic
994644523 5:102451580-102451602 TGGGGGAATCTCCTGTGCCCAGG + Intronic
995061481 5:107815418-107815440 GTGGAGAAGCTCCTGAGAACAGG - Intergenic
996381876 5:122870733-122870755 TGGGGGAAGTGCCTGAGACATGG + Intronic
997228989 5:132229071-132229093 TGGGGCAAACTCCTGAGAAGGGG - Intronic
997472236 5:134123496-134123518 CAGGGGAGGCTCCTGAGAGAGGG + Intronic
997580341 5:135012971-135012993 TGGGGGAATCCTCTGAGGGCAGG + Intergenic
997705868 5:135951972-135951994 TAGGGGAGGCTGGTGAGAGCAGG - Intronic
1001468367 5:171988947-171988969 TGGGCGAATCTCCTGAGGTCAGG + Intronic
1001547056 5:172576884-172576906 TGGAGGTAGCTTCTGAAAGCAGG + Intergenic
1002868001 6:1141045-1141067 TGGGTGAATCACCTGAGGGCAGG + Intergenic
1003320532 6:5046996-5047018 TGGGAGAATCTCCTGAGCCCAGG + Intergenic
1004521199 6:16362464-16362486 TGGGGGTAACTGCTGAGAGCGGG - Intronic
1004633302 6:17442585-17442607 TGCCAGAAGTTCCTGAGAGCTGG + Intronic
1005017979 6:21391890-21391912 TGGGTGAATCACCTGAGATCAGG + Intergenic
1005264219 6:24094399-24094421 TGGGGGGATCACCTGAGATCAGG + Intergenic
1005618889 6:27601901-27601923 TGGGGAAAGCTCCTGAAAGGTGG + Intergenic
1006984557 6:38168147-38168169 TGAGGGAAGGCCCTCAGAGCCGG + Intergenic
1007119053 6:39365446-39365468 TGGGGGAAGACACTAAGAGCAGG - Intronic
1010579154 6:77572941-77572963 TGGGTGAATCTCCTGAGCTCAGG + Intergenic
1011473035 6:87726714-87726736 TGGGAGAATCACCTGAGATCAGG + Intergenic
1011729824 6:90249677-90249699 TGGGGGAATCACCTGAGCCCAGG + Intronic
1013072736 6:106743674-106743696 TGGGGGAAGCTCTTGTCAACAGG + Intergenic
1013490161 6:110638662-110638684 TGGGAGAAGGTCCTGAGAGGGGG - Exonic
1013618020 6:111862816-111862838 TGGGGGAAGCTTTTGAGAGTTGG + Intronic
1014001527 6:116370938-116370960 CGGGCGACGCTACTGAGAGCCGG - Exonic
1015242745 6:131044112-131044134 TGGGAGAATCTCCTGAGCTCAGG - Intronic
1015250401 6:131121565-131121587 TGGGAGAATCTCCTGAGCCCAGG - Intergenic
1016405045 6:143720838-143720860 TGGGAGAATCACCTGAGATCAGG - Intronic
1017065095 6:150521118-150521140 TGTGAGAAGCTCCTGATAACAGG + Intergenic
1017071660 6:150580389-150580411 TAGGGGAAGCTGCTGGGAACAGG - Intergenic
1018136323 6:160781463-160781485 AGGGGGAAGCCCCTGAGAAAAGG + Intergenic
1018436263 6:163761995-163762017 TGGGCGAATCACCTGAGATCAGG - Intergenic
1018893647 6:167999168-167999190 TGGGGGATGCTCCGCAGTGCAGG + Exonic
1018971355 6:168531595-168531617 TTGGGGATGCTCTGGAGAGCTGG + Intronic
1019139001 6:169931377-169931399 TTGGGGAAGCTGCTGAGAGTGGG - Intergenic
1021355513 7:19650274-19650296 TGCGGGAATCTCCTGAGCCCAGG - Intergenic
1021782596 7:24120516-24120538 TGGGGAAAGCTTCGCAGAGCAGG + Intergenic
1021801058 7:24306710-24306732 TGGTGGAAGCTCAAGAGAGCAGG + Intergenic
1021926507 7:25539477-25539499 TGAGGGAAGTTCCTGAGACCGGG + Intergenic
1023863593 7:44228716-44228738 GGTGGGAAGCTGCTGAGCGCCGG + Intronic
1024353098 7:48387583-48387605 TGGGGGAAGTGGCTGAGAGGGGG + Intronic
1024941462 7:54767536-54767558 TGGAGGAAGAGCCTGAGACCCGG - Intergenic
1026593421 7:71714992-71715014 GGGGGGAAGCTGCTGACAGATGG - Intergenic
1026778385 7:73246595-73246617 TGGGAGAATCACCTGAGGGCAGG + Intergenic
1027019242 7:74799989-74800011 TGGGAGAATCACCTGAGGGCAGG + Intronic
1027068786 7:75145949-75145971 TGGGAGAATCACCTGAGGGCAGG - Intronic
1029262391 7:99312202-99312224 TGGGGGAATCACCTGAGGTCGGG - Intergenic
1029695104 7:102207677-102207699 TGGGGGGATCACCTGAGATCAGG - Intronic
1030664489 7:112260171-112260193 TGGGAGAATCTCCTGAGCCCAGG + Intronic
1032015684 7:128379139-128379161 AGGGGGCAGCCCCAGAGAGCTGG - Intergenic
1032415843 7:131734777-131734799 TGGGGGAATCTTCTAAAAGCAGG + Intergenic
1033308376 7:140241131-140241153 TGGGCGGATCTCCTGAGATCGGG - Intergenic
1033566228 7:142580831-142580853 TGGAGGAAGGTCCTTTGAGCAGG + Intergenic
1034202910 7:149293596-149293618 TGGGCGAGGCTCCTGAGGGAAGG + Intronic
1034919643 7:155069818-155069840 TAAGGGAAGCAACTGAGAGCTGG + Intronic
1035061596 7:156073454-156073476 TTGGGAAAGCTGCTGATAGCCGG - Intergenic
1035207670 7:157304766-157304788 TGGGAGAATCTCCTGAGCCCAGG - Intergenic
1035559411 8:593602-593624 TGAGGGGAGCCCCTGAGAGGAGG + Intergenic
1035597114 8:866853-866875 TGGGAGAAGCTGCTCAGAGCCGG + Intergenic
1036130016 8:6101444-6101466 TTGTGAAAGCTCCTAAGAGCCGG - Intergenic
1037199762 8:16238373-16238395 TGGGGGAATCACCTGAGGTCAGG - Intronic
1037288919 8:17330316-17330338 TGGGGAAAGCCCTGGAGAGCTGG - Intronic
1037322373 8:17656298-17656320 TGGGGGAATCACCTGAGGTCAGG + Intronic
1037668796 8:20996902-20996924 TGGGGGAGGCTGCGGAGCGCGGG - Intergenic
1037786881 8:21908641-21908663 TGGGGGAAGCACGGGGGAGCGGG - Intergenic
1037959726 8:23087335-23087357 TGTGGGAAGTCCCTTAGAGCAGG + Intronic
1038035738 8:23684732-23684754 TGGGAGAATCTCCTGAGCCCAGG - Intergenic
1038541606 8:28394645-28394667 TGGGTGAATCACCTGAGATCAGG + Intronic
1038714951 8:29983198-29983220 TGGGGGAATCTCTTGAGCCCAGG - Intergenic
1039715435 8:40103280-40103302 TGGGCCCAGCTTCTGAGAGCGGG + Intergenic
1040011812 8:42667537-42667559 TGGGGGAATCACCTGAGGTCAGG - Intergenic
1041073062 8:54143859-54143881 TGGGGGAAGCTCCAGGCAGGAGG - Intronic
1041653185 8:60321704-60321726 TGGTGGAAGCTGCTCAGAGATGG - Intergenic
1041798209 8:61769650-61769672 TGGGGAAATCACCTGAGATCAGG + Intergenic
1043963046 8:86439419-86439441 TGGGGGAATCTCTTGAGCTCAGG - Intronic
1044964400 8:97561110-97561132 TGGGCGGAGCTCATGAGTGCAGG + Intergenic
1047269591 8:123343201-123343223 TGGGCGAATCACCTGAGATCAGG - Intronic
1047398461 8:124525372-124525394 TGGGTGGAGCTCCTGAGGTCAGG - Intronic
1047647087 8:126880573-126880595 TGGGTGAATCTCTTGAGACCAGG + Intergenic
1047937377 8:129796246-129796268 TGGGTGGAGCACCTGAGATCAGG - Intergenic
1047939657 8:129816675-129816697 TGGGGGAAGCTCCCTAATGCGGG - Intergenic
1048999380 8:139815032-139815054 TGGGGGAAGCTGCTAAGAGTCGG - Intronic
1049330729 8:142049104-142049126 TGGGGCAGACTACTGAGAGCTGG - Intergenic
1049399255 8:142417554-142417576 TAGGGGCAGCTCCTGTGAGGAGG - Intergenic
1049511148 8:143027199-143027221 TGGGGGTGGCTCCTGAGAGCAGG + Intergenic
1049747183 8:144267967-144267989 TGAGGGAAGCTGGGGAGAGCCGG + Intronic
1049978422 9:882112-882134 AGGAGGAAGCTGCAGAGAGCAGG + Intronic
1052927997 9:34033668-34033690 TGGGAGAATCTCTTGAGCGCAGG - Intronic
1054707250 9:68475260-68475282 TGGGGGAATCACCTGAGGTCAGG - Intronic
1056153493 9:83812438-83812460 TGGGAGAATCACCTGAGACCAGG - Intronic
1056356996 9:85810652-85810674 TGGGAGAATCACCTGAGACCAGG + Intergenic
1056436576 9:86580399-86580421 TGCGGGAAGCTTCTGGAAGCTGG + Intergenic
1056679829 9:88707052-88707074 TGGGGGAAGCTCCTGAAGGTTGG + Intergenic
1056770732 9:89476193-89476215 TGGGGCAGGCTTCTGGGAGCAGG + Intronic
1056792772 9:89636862-89636884 TGGGCGAATCTCTTGAGAACAGG + Intergenic
1056911048 9:90701002-90701024 ATGGTGAAGCTCCTCAGAGCCGG - Intergenic
1057346376 9:94254534-94254556 TGGGGAAATCACCTGAGATCAGG - Intergenic
1057471098 9:95357397-95357419 TGGGCGAATCACCTGAGATCAGG - Intergenic
1057607510 9:96510831-96510853 TGGGCGAATCACCTGAGATCAGG - Intronic
1058880989 9:109285847-109285869 TTGGGGAGGCTCCTGAAAGACGG - Intronic
1059474169 9:114530653-114530675 TGGGAGAATCACCTGAGTGCAGG + Intergenic
1060180685 9:121531647-121531669 TGGGTGAAGCACCTGAGGTCAGG - Intergenic
1060225687 9:121788926-121788948 TGGGGGAAATACCTGGGAGCTGG - Intergenic
1060264536 9:122102883-122102905 TGGGAGGATCTCCTGAGATCAGG + Intergenic
1061497117 9:130981497-130981519 TGGGAGAGGCTCCTGCGAGGTGG - Intergenic
1061514714 9:131082303-131082325 TGGGGCAGGATCCTGAGAGGTGG - Intronic
1061748210 9:132755476-132755498 AGAGGGAAGCTCCTGGGAGAGGG + Intronic
1061906639 9:133702578-133702600 TCGGCGCAGCTCCGGAGAGCGGG + Intronic
1061908511 9:133710981-133711003 GGTGGGGAGCCCCTGAGAGCTGG - Intronic
1062343333 9:136103527-136103549 GGGGGGCAGCCCCTGAGGGCTGG + Intergenic
1062446608 9:136597900-136597922 CTGGGGAAGCCCCTGAGTGCGGG + Intergenic
1062525928 9:136978143-136978165 TCGGGGAAGCGCCGGAGCGCGGG + Intronic
1062526369 9:136979544-136979566 TGGGGAAAACTCCAGAGGGCAGG - Intronic
1062577196 9:137214281-137214303 TGACGGGGGCTCCTGAGAGCCGG - Exonic
1203376137 Un_KI270442v1:380257-380279 TGGTGGAAGCTCCGGAGCTCGGG + Intergenic
1185628992 X:1502537-1502559 TGGGGAAGGCTGCTGAGAGTAGG - Intronic
1186059136 X:5684961-5684983 TGGGGGGATCACTTGAGAGCTGG - Intergenic
1186517451 X:10176561-10176583 TGGGAGAGGCTCATGAGAGCCGG + Intronic
1188404120 X:29785872-29785894 TGGGGGAATCTTCTGAGATAAGG + Intronic
1189187761 X:39068904-39068926 AGGGGGTAGCTCCTGAAATCAGG - Intergenic
1189226716 X:39419430-39419452 TGGCAGAAGCTCTTAAGAGCTGG - Intergenic
1189799607 X:44680145-44680167 TGGGTGAATCACCTGAGATCAGG + Intergenic
1190243289 X:48674392-48674414 TGGGCGAATCACCTGAGGGCAGG - Intergenic
1190279656 X:48921361-48921383 TGGGTGAATCACCTGAGATCAGG - Intergenic
1190826851 X:54025668-54025690 TGGGGGATGGTCATGAGAGTTGG - Intronic
1192480770 X:71483492-71483514 TGGGAGGATCCCCTGAGAGCAGG + Intronic
1192741719 X:73899731-73899753 TGGGCGAATCACCTGAGATCAGG + Intergenic
1195052373 X:101108736-101108758 TGGGGGAAACACCTGAGCCCAGG - Intronic
1195320954 X:103721654-103721676 CCTGGGAAGTTCCTGAGAGCTGG + Intronic
1195570525 X:106394305-106394327 TGGGGGAAGACCCTGAGGCCTGG + Intergenic
1196119276 X:112031181-112031203 TAGGGGAACCTCCGGAGAGTTGG - Intronic
1197884136 X:131200419-131200441 TGGGGGAATCACCTGAGGTCAGG + Intergenic
1198194622 X:134347608-134347630 TGGGCGAATCACCTGAGATCAGG - Intergenic
1198400482 X:136263660-136263682 TGGGTGAATCACCTGAGATCAGG - Intergenic
1198794798 X:140383657-140383679 TGAGAGCAGCTCCTAAGAGCTGG - Intergenic
1199236857 X:145502669-145502691 TGGGGGAAGCTACTGAAAAATGG + Intergenic
1199723802 X:150562938-150562960 TGGGGGAAGCTTCTGATCCCTGG + Intergenic
1200798906 Y:7367862-7367884 TGGGAGAATCACCTGAGACCAGG - Intergenic
1200922220 Y:8623356-8623378 TGCAGGAAGCTCCTGAGATAGGG - Intergenic
1202584084 Y:26406362-26406384 TGGGGGAAGCTATTGAGGGCAGG - Intergenic