ID: 1069898221

View in Genome Browser
Species Human (GRCh38)
Location 10:71691998-71692020
Sequence ACAGTGAGCCCTCATTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069898211_1069898221 7 Left 1069898211 10:71691968-71691990 CCCTCCTCCCAGCTCTCAGGAGC 0: 1
1: 0
2: 6
3: 59
4: 545
Right 1069898221 10:71691998-71692020 ACAGTGAGCCCTCATTCCCAGGG No data
1069898215_1069898221 -1 Left 1069898215 10:71691976-71691998 CCAGCTCTCAGGAGCTTCCCCCA 0: 1
1: 0
2: 4
3: 42
4: 528
Right 1069898221 10:71691998-71692020 ACAGTGAGCCCTCATTCCCAGGG No data
1069898214_1069898221 0 Left 1069898214 10:71691975-71691997 CCCAGCTCTCAGGAGCTTCCCCC 0: 1
1: 0
2: 3
3: 22
4: 281
Right 1069898221 10:71691998-71692020 ACAGTGAGCCCTCATTCCCAGGG No data
1069898213_1069898221 3 Left 1069898213 10:71691972-71691994 CCTCCCAGCTCTCAGGAGCTTCC 0: 1
1: 0
2: 2
3: 37
4: 388
Right 1069898221 10:71691998-71692020 ACAGTGAGCCCTCATTCCCAGGG No data
1069898212_1069898221 6 Left 1069898212 10:71691969-71691991 CCTCCTCCCAGCTCTCAGGAGCT 0: 1
1: 0
2: 5
3: 56
4: 495
Right 1069898221 10:71691998-71692020 ACAGTGAGCCCTCATTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069898221 Original CRISPR ACAGTGAGCCCTCATTCCCA GGG Intronic
No off target data available for this crispr