ID: 1069898824

View in Genome Browser
Species Human (GRCh38)
Location 10:71695508-71695530
Sequence GACTCTGATGTGACCACGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069898818_1069898824 -1 Left 1069898818 10:71695486-71695508 CCTGGTGGAGATGACCCCTCCAG 0: 1
1: 0
2: 2
3: 11
4: 132
Right 1069898824 10:71695508-71695530 GACTCTGATGTGACCACGGTAGG 0: 1
1: 0
2: 2
3: 4
4: 64
1069898813_1069898824 30 Left 1069898813 10:71695455-71695477 CCACGTGGAAGGACGCACCCTAC 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1069898824 10:71695508-71695530 GACTCTGATGTGACCACGGTAGG 0: 1
1: 0
2: 2
3: 4
4: 64
1069898817_1069898824 12 Left 1069898817 10:71695473-71695495 CCTACTACATCAACCTGGTGGAG 0: 1
1: 0
2: 2
3: 4
4: 79
Right 1069898824 10:71695508-71695530 GACTCTGATGTGACCACGGTAGG 0: 1
1: 0
2: 2
3: 4
4: 64
1069898816_1069898824 13 Left 1069898816 10:71695472-71695494 CCCTACTACATCAACCTGGTGGA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1069898824 10:71695508-71695530 GACTCTGATGTGACCACGGTAGG 0: 1
1: 0
2: 2
3: 4
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069898824 Original CRISPR GACTCTGATGTGACCACGGT AGG Intronic
900779135 1:4606174-4606196 GACTCTGATGGGCCCACGATGGG - Intergenic
906795295 1:48692000-48692022 GATTCTGATATGACAAGGGTTGG - Intronic
907622571 1:55996310-55996332 GACTCTGAAATGGCCACTGTGGG - Intergenic
915786370 1:158617262-158617284 GACTCTGATCTGCCCAGAGTGGG - Intronic
919167624 1:193916080-193916102 TACTCTGTTCTGACCACAGTAGG - Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1065832380 10:29626569-29626591 GAGTCTGCTGTGACCACTTTGGG + Intronic
1069152669 10:64984737-64984759 CACCCTGATGTGCCCACAGTTGG + Intergenic
1069898824 10:71695508-71695530 GACTCTGATGTGACCACGGTAGG + Intronic
1070831419 10:79420211-79420233 GACTCTGCTGTGCCCAGGATGGG - Intronic
1071046494 10:81386034-81386056 GACTCTGATGTGGCCAGGTGTGG + Intergenic
1081695327 11:45105586-45105608 GGCTCTGCTGTCACCACGGCTGG - Intronic
1083860823 11:65419099-65419121 ACCTCTCATGTGACCAGGGTAGG - Intergenic
1089168765 11:116498310-116498332 CACTCTGATGAGCCCACGCTGGG - Intergenic
1094281588 12:28746008-28746030 GACTCTGATGTGTCTACGAGTGG + Intergenic
1102051039 12:109862129-109862151 GCCTCTGACGTGACCACCCTAGG - Intronic
1114141643 14:19918154-19918176 GACTGTCATGTGACTACTGTAGG - Intergenic
1122120403 14:99550314-99550336 GAGGGAGATGTGACCACGGTGGG + Intronic
1128355524 15:66923828-66923850 GAGTGTGATTTGAGCACGGTGGG + Intergenic
1130063274 15:80584671-80584693 CACTCAGATGTGCCCACGCTGGG - Intronic
1130338043 15:82974480-82974502 GACTCTGTTTTCACCATGGTAGG - Intronic
1130664553 15:85858882-85858904 GACTCTGAGCACACCACGGTCGG + Intergenic
1132303706 15:100793011-100793033 GACTCTGATGTGCCCTGGCTTGG - Intergenic
1132345318 15:101104700-101104722 GAGTCGGATGTCACCACAGTTGG + Intergenic
1132828440 16:1916396-1916418 GACACTGACGTGCCCAGGGTTGG - Intronic
1133783772 16:8959500-8959522 CACTCTGATGTGAGCACGTCAGG - Intronic
1158702269 18:59759039-59759061 ACATCAGATGTGACCACGGTGGG + Intergenic
1158821977 18:61170754-61170776 CACTCTGCTGTGACCAGGGAGGG - Intergenic
1162496921 19:11028547-11028569 GACTCTGTGGTGAGCACGGAGGG + Intronic
1164951026 19:32337243-32337265 GAATTTGATGTGAGCACGTTAGG - Intergenic
1164980110 19:32607488-32607510 GATTCTGAGGTGCACACGGTAGG - Intronic
925014771 2:514434-514456 GGTTCTGATGTGGCCCCGGTAGG + Intergenic
925874953 2:8303639-8303661 GGCTCCGATGTGGCCACGTTTGG - Intergenic
935932150 2:108138993-108139015 CACTTTGATGTGAGCATGGTGGG - Intergenic
940459073 2:153939335-153939357 GTCACTGATGTGAACATGGTAGG + Intronic
945117850 2:206426732-206426754 GAATCTGATGTGACCAAGGTAGG + Intergenic
1168857821 20:1021260-1021282 GACTTTGGTGTGTCCACCGTGGG + Intergenic
1168905586 20:1400928-1400950 GACTGTGTCGTGACCCCGGTCGG - Intergenic
1170095241 20:12638916-12638938 GACTCTAATGTGATCACTGCTGG + Intergenic
1173170466 20:40719376-40719398 GACACTCATGTGACAACTGTGGG - Intergenic
1174486320 20:50863668-50863690 GACTCTGATGTGACAGCAGTTGG + Intronic
1185375312 22:50480295-50480317 GTCTCTGATGTGAGGACGGTCGG + Intergenic
954856483 3:53648333-53648355 GGGTCTGATGTGAGCACTGTGGG + Intronic
956044647 3:65182562-65182584 GATTCTGATGTCTCCACAGTGGG - Intergenic
960948121 3:122980864-122980886 GTCTCTGATTTGACTACTGTAGG + Intronic
967772634 3:193351702-193351724 GACTCTTATGTGACCTTGCTAGG - Intronic
969853249 4:9978793-9978815 GCCTCTGAGGTGACCTCGATTGG + Intronic
983618619 4:169735784-169735806 GTCTCTGATGGGACCATTGTGGG - Intronic
992308540 5:75468666-75468688 GAATCTGTTGTTACCACGGCTGG - Intronic
1006404245 6:33834916-33834938 GGCTCTGATGTGCCCAGGGTTGG - Intergenic
1006905101 6:37528023-37528045 GCCTCTGAGGTGGCCAGGGTAGG + Intergenic
1012260843 6:97085596-97085618 GACTCAGATGTGACCACGTTAGG - Intronic
1012978629 6:105806760-105806782 GACTCTGTTGAAACCATGGTAGG - Intergenic
1017748848 6:157471322-157471344 GACTCAGCTTTGACTACGGTGGG + Intronic
1034899432 7:154898411-154898433 GACCGTGATGTGACCCAGGTGGG - Intergenic
1037993937 8:23339511-23339533 GACTCTGGACTGGCCACGGTTGG + Intronic
1039743370 8:40402170-40402192 GACTCTGATGTGAACACCCATGG + Intergenic
1040484236 8:47854993-47855015 GCCTCTGATGTCCCCACGCTGGG - Intronic
1045034662 8:98167743-98167765 GACTCTGTGGTCACCACAGTAGG - Intergenic
1046474876 8:114729139-114729161 GACTCATATGTGACCACCCTTGG + Intergenic
1051237155 9:15013414-15013436 GTCTCTGATGGGACCAGTGTGGG + Intergenic
1056085022 9:83139324-83139346 GACTATGCTGGGACCAGGGTTGG - Intergenic
1056452839 9:86733440-86733462 GACTCTGTCGTGCCCACTGTGGG - Intergenic
1058987771 9:110224692-110224714 GGCTCTGGGGTGACCAGGGTAGG + Intergenic
1061945534 9:133906574-133906596 AACACTGATGAGACCATGGTTGG + Intronic
1062595395 9:137296881-137296903 GTCTCTGATCTGACCCCGGCTGG - Intergenic
1197868069 X:131039228-131039250 GATTCTGATGTGCCCACAATTGG + Intergenic
1198576384 X:138014476-138014498 GGCTCTGGTGTGACCACAGGAGG - Intergenic
1199186416 X:144920727-144920749 GACTCTGCTTTGACCACCTTGGG - Intergenic
1199849565 X:151715714-151715736 AACTCTGTTGTGGCCACTGTTGG + Intergenic