ID: 1069900000

View in Genome Browser
Species Human (GRCh38)
Location 10:71701751-71701773
Sequence AAACCCTGGATTTTGGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 276}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069900000_1069900003 3 Left 1069900000 10:71701751-71701773 CCAGTCTCCAAAATCCAGGGTTT 0: 1
1: 0
2: 1
3: 25
4: 276
Right 1069900003 10:71701777-71701799 ATCCTTTCAAAAATCTTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069900000 Original CRISPR AAACCCTGGATTTTGGAGAC TGG (reversed) Intronic
903756325 1:25663936-25663958 AACCCCTGGTTTTGTGAGACAGG - Intronic
905853323 1:41290376-41290398 AGACCATAGATTTTGGAGCCAGG + Intergenic
907929419 1:58985511-58985533 AAACCCAGGATCTTAGAGAAAGG + Intergenic
908229283 1:62087649-62087671 AAAGCCAGGATTTTCTAGACGGG - Intronic
909195084 1:72609934-72609956 ATACCCTGGATAATAGAGACAGG - Intergenic
911273988 1:95839226-95839248 AAATCTTGGAATTTGAAGACAGG - Intergenic
911717043 1:101144853-101144875 AAACCATGAGCTTTGGAGACAGG - Intergenic
912379880 1:109241547-109241569 AAGCCCTGCATTTTGGAGATTGG + Intergenic
913045791 1:115072645-115072667 ACTCCCTTGATTTTGGAGAGCGG + Intronic
913615442 1:120555478-120555500 AAATACTGTATTTTGGTGACTGG - Intergenic
915277186 1:154797282-154797304 AAAACCTGGACTTCGGAGTCAGG + Intronic
915477654 1:156162487-156162509 CAACCCTGGTCTGTGGAGACAGG - Intronic
916590226 1:166183001-166183023 AGAACCTGGTGTTTGGAGACTGG - Intergenic
920014799 1:202898073-202898095 CTACCTTGGCTTTTGGAGACAGG + Intronic
920554101 1:206891439-206891461 CAACCCTGGATATATGAGACAGG + Intergenic
923020751 1:230161506-230161528 AAAGAATGGATTTTGGGGACTGG - Intronic
923365882 1:233260179-233260201 AAACACTGGATTTAGTAGCCAGG + Intronic
923652239 1:235884485-235884507 AAACCATGGCTTTGGGAGACTGG - Intergenic
924100265 1:240595666-240595688 AAAGCCTGGGCTTTGGAGTCAGG + Intronic
924145046 1:241065044-241065066 AAACCATGGATTTTAGAATCGGG + Intronic
924483459 1:244457236-244457258 AAACCCTGTGATTTGGACACAGG - Intronic
1063945276 10:11169974-11169996 AAACCATGGGATTTGGTGACTGG + Intronic
1064603388 10:17015273-17015295 CAACCCTGGAGTCTGGACACTGG - Intronic
1065000733 10:21335560-21335582 AACCCATGGATTGTGGAGAGTGG - Intergenic
1065189148 10:23194819-23194841 AGACCCTGGATTTTGTTGAGTGG - Intergenic
1065298445 10:24299213-24299235 AGAACCTGGATTTTAGAGCCTGG - Intronic
1067705388 10:48603225-48603247 AAATCCTGGATTTCAAAGACAGG + Intronic
1069566432 10:69466344-69466366 AACCCCCTGATTTTGCAGACGGG - Intronic
1069640690 10:69953783-69953805 AAAAGCTGGATTTGGGAGATGGG + Intronic
1069694691 10:70377893-70377915 AAAACACTGATTTTGGAGACAGG + Intronic
1069900000 10:71701751-71701773 AAACCCTGGATTTTGGAGACTGG - Intronic
1070045254 10:72827881-72827903 AAACCCTGGACATTGGATAGTGG - Intronic
1070045270 10:72828092-72828114 AAGCACTGAATTTTGGAGACAGG + Intronic
1070592661 10:77811765-77811787 CAGCCCTGGATTTTGGAAAAGGG - Intronic
1071139194 10:82487520-82487542 TTAACCTGGATTCTGGAGACTGG - Intronic
1071443297 10:85723317-85723339 AAACCATGGATCTTGGACAAGGG + Intronic
1074964492 10:118478063-118478085 AAACCCTGAAGTTTTGAGTCTGG - Intergenic
1075444398 10:122503742-122503764 AAACCCTGGATTTCTGTGAAAGG - Intronic
1075709028 10:124520849-124520871 ACACACTGGATTTCAGAGACTGG + Intronic
1075806564 10:125193381-125193403 TAGCCCTGGATGTTGGACACTGG - Intergenic
1076222832 10:128748353-128748375 AAACCGTTTATTTTTGAGACAGG + Intergenic
1079123458 11:17701355-17701377 AGCCACTGGATTTTGGAGAGCGG + Intergenic
1079935889 11:26615452-26615474 AAACACGGGACTTTGGACACAGG + Intronic
1083033347 11:59614845-59614867 TAACCTTGAGTTTTGGAGACTGG + Intronic
1083109906 11:60396067-60396089 AAAACATAGATTTTGGAGACAGG + Intronic
1083814656 11:65125843-65125865 AAAGCCTGGCTCTTGGAGAAAGG + Exonic
1084130578 11:67130971-67130993 AAACCTGGGAGTTTGGAGTCAGG - Intronic
1087116355 11:94529148-94529170 AAAGCATGGACTTTGGAGACAGG - Intergenic
1088035335 11:105305627-105305649 ATACCATGGATTTTGGAGCCAGG + Intergenic
1089009774 11:115122946-115122968 AAAGCATGGATTTTGAAGCCTGG - Intergenic
1089188933 11:116640552-116640574 AAACCCTTCATTGTGAAGACTGG + Intergenic
1090126504 11:124091254-124091276 AAAACATGGATATTGAAGACAGG + Intergenic
1090245475 11:125213112-125213134 AGAGCCTGGATTTAGAAGACAGG - Intronic
1090942647 11:131401351-131401373 AAAACATGGATTTTGAAAACAGG + Intronic
1091615428 12:2047495-2047517 AGAGCCTGGTCTTTGGAGACAGG - Intronic
1092066733 12:5596445-5596467 AAAGGTTGGATTTGGGAGACAGG + Intronic
1092299761 12:7235684-7235706 AAGACCAGGATTTTGGAGGCTGG + Intergenic
1093858717 12:24137096-24137118 AGAAGCTGGATTTTGGAAACTGG - Intergenic
1094802533 12:34053282-34053304 ATACAATGGACTTTGGAGACGGG + Intergenic
1095503677 12:42868797-42868819 AAAGCATGGATTTTGGAGTTGGG + Intergenic
1097046540 12:56190846-56190868 AACCCCTGGATTTGGGAGGATGG + Intergenic
1097224033 12:57466398-57466420 AGACCCTGGACTTGGGACACTGG - Intronic
1097955504 12:65481545-65481567 AAACCCTGTCTTGTAGAGACAGG - Intronic
1100207419 12:92365774-92365796 ACATCTTGGATTTTGGTGACAGG + Intergenic
1101893319 12:108734516-108734538 AAACCGTGGACTTTGGATTCTGG + Intergenic
1103006063 12:117421246-117421268 AAAACCTGGGTCTTGGAGGCAGG + Intronic
1103176225 12:118865719-118865741 AAACCCTGGATTAGGAAGTCAGG + Intergenic
1106562198 13:30856622-30856644 CATCCCTGGATTTTTGAGATAGG + Intergenic
1106989610 13:35401970-35401992 AAACCCAAGATTTTGTACACAGG - Intronic
1107142494 13:37016680-37016702 AAACTCTGGATTTGGGACTCAGG + Intronic
1109094725 13:58098196-58098218 ACTCCCTGGATTGAGGAGACAGG - Intergenic
1109404887 13:61885158-61885180 CCACTTTGGATTTTGGAGACAGG + Intergenic
1111270604 13:85878299-85878321 AAACCATAGATTTAGGAGACCGG - Intergenic
1112350486 13:98629157-98629179 AAAGCCTGCATTTTAGATACAGG + Intergenic
1112758533 13:102668075-102668097 AAAGGTTGGTTTTTGGAGACAGG + Intronic
1112758537 13:102668128-102668150 AAAGGTTGGTTTTTGGAGACAGG + Intronic
1115872684 14:37822751-37822773 AAAGCATGGATTTTGGAGTAAGG + Intronic
1118001464 14:61527264-61527286 GAAGCCTAGATTATGGAGACTGG - Intronic
1118032651 14:61833536-61833558 AATCCCAGCACTTTGGAGACAGG - Intergenic
1118281129 14:64429609-64429631 AAATCCTGGATTTGGGATGCTGG + Intronic
1120904949 14:89612063-89612085 AAAGCCTGGGATTTGGAGTCAGG + Intronic
1121499971 14:94427348-94427370 AAACACTGGCTTTTGGTGGCGGG - Intergenic
1121519270 14:94574817-94574839 AGAACCTGGACTTTGGAGCCAGG + Intronic
1121820089 14:96959101-96959123 GGAGCCTGGACTTTGGAGACGGG + Intergenic
1124931480 15:34124032-34124054 AAATCCAAGATTTAGGAGACTGG + Intergenic
1127626132 15:60781836-60781858 AAATCCCAGATTTTGGAGTCTGG + Intronic
1129597538 15:76976189-76976211 AGAATATGGATTTTGGAGACAGG + Intergenic
1129605179 15:77021348-77021370 GATCCCTGGAGTTTGGGGACTGG - Intronic
1129747247 15:78031821-78031843 AAACCATGGTTTTTGGATATTGG + Intronic
1129946758 15:79545255-79545277 AAACACAGGATTTTGGTGGCAGG - Intergenic
1130137764 15:81196216-81196238 AAAGCCTGGGCTTTGGAGACAGG + Intronic
1130853016 15:87816590-87816612 AGAATATGGATTTTGGAGACAGG - Intergenic
1132921273 16:2395735-2395757 AAAGCATGGACTTTGGAGTCAGG - Intergenic
1133803899 16:9108286-9108308 AAAATTTGCATTTTGGAGACAGG - Intronic
1134001366 16:10785542-10785564 AAACCCTGAATATCTGAGACAGG + Intronic
1135744012 16:25000308-25000330 AAAGCATGTATTTTGGACACAGG + Intronic
1135752103 16:25066256-25066278 AAACCCTGGTGTTTGGGGAAAGG - Intergenic
1137953044 16:52801845-52801867 AAACCCAGGGTTTTGAAGTCAGG - Intergenic
1138717500 16:59040737-59040759 AAAGCATGGGTTTTGGAGTCAGG + Intergenic
1138962696 16:62046255-62046277 AAGCTGTGGATCTTGGAGACTGG + Intergenic
1142698672 17:1646906-1646928 AAACTCTGTATTTTGGACTCCGG + Exonic
1143389398 17:6551376-6551398 AAAGCCTGGAGTCTGGACACTGG + Intronic
1143420674 17:6789228-6789250 CAAACCTGGCTTTTGGAGCCAGG + Intronic
1144037098 17:11376866-11376888 AAATCCGGGATTCTGGAGCCGGG + Intronic
1147213720 17:38887071-38887093 AACCCCAGGGTTTTGCAGACCGG + Intronic
1148876468 17:50690303-50690325 AAGACCTTGATTTTGGAGTCAGG + Intronic
1150237156 17:63602289-63602311 AAACTGTGGACTTTGGAGTCAGG + Intronic
1154375302 18:13804007-13804029 AAACACTGGACTTTGGAGAAAGG + Intergenic
1155771918 18:29712257-29712279 AAACCCTAGTTCTTAGAGACTGG - Intergenic
1157620944 18:49017235-49017257 ACACCCTGGATGTGGGAGAATGG - Intergenic
1158551482 18:58439798-58439820 AAAACTTGTATTTTAGAGACAGG + Intergenic
1160228639 18:77029884-77029906 GAAACCTGGATTTTTGAGCCAGG - Intronic
1164889601 19:31812111-31812133 AGACCCAGGAAATTGGAGACAGG + Intergenic
1166591873 19:44006717-44006739 AATCCATGGATTTTGGTGACTGG + Intronic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
1167708743 19:51097776-51097798 AAACCTTGGACTCTGGAGGCAGG - Exonic
1168529165 19:57113518-57113540 GAACCATGGATGTTGGGGACAGG - Intergenic
925586409 2:5469060-5469082 CAACCCTGGATTAAGGAGAAGGG + Intergenic
925930375 2:8702556-8702578 GAACCCCGAATATTGGAGACGGG + Intergenic
926906988 2:17815438-17815460 AGACCCTGGGTTTTGGAAAAGGG - Intergenic
927300447 2:21506172-21506194 ATACCCTGAATATTGGAGACAGG + Intergenic
928016263 2:27660795-27660817 AGACCCTGAATTCTGAAGACTGG + Intronic
929051493 2:37840640-37840662 AAACACTGGATTGTGTACACAGG + Intergenic
929389663 2:41455524-41455546 AAAGCATGAATTTTGGAGCCAGG + Intergenic
930147204 2:48019434-48019456 AGGACATGGATTTTGGAGACTGG + Intergenic
931384810 2:61788661-61788683 AAACCCTGGCTCTTAGAGGCAGG - Intergenic
933589476 2:84215841-84215863 AAATCCTGGCACTTGGAGACAGG - Intergenic
934088832 2:88533093-88533115 AAAATCTTGATTTTGGAGTCAGG + Intergenic
934134895 2:88985853-88985875 AAACTCAGTATTTTTGAGACTGG + Intergenic
934235415 2:90227900-90227922 AAACTCAGTATTTTTGAGACTGG - Intergenic
938103573 2:128514376-128514398 AAACCCTGCTTTGTGGAGAGGGG - Intergenic
938141295 2:128796730-128796752 AAAGCCTGGAGTGTGGACACAGG - Intergenic
938580516 2:132641914-132641936 ACAGCATGGATTTTGGAGTCTGG + Intronic
941504344 2:166322811-166322833 AAAGCCTGGGTTTTGAATACTGG + Intronic
941785497 2:169493561-169493583 ACAGCCTGGACTTTGGAGTCAGG - Intronic
942606106 2:177692940-177692962 GAGCCCTGCCTTTTGGAGACAGG - Intronic
942686178 2:178534459-178534481 AAGCCATGGATTTTGTTGACCGG - Exonic
943437972 2:187891150-187891172 AAACCCTGAAAATTTGAGACAGG + Intergenic
944556557 2:200893068-200893090 AAGCCCTAGATTATGGGGACTGG + Intronic
946617935 2:221529755-221529777 AAACCCTCGGTGTTGGAGACTGG - Intronic
947232050 2:227898219-227898241 AAACTCTGGAGTGTGGAAACAGG + Exonic
947350238 2:229235997-229236019 AAAGCCTGTATTTTGAAGAAAGG + Intronic
1169406128 20:5322726-5322748 GAAGCCTAGATTTTGGAGTCTGG - Intergenic
1172035019 20:32004517-32004539 AAACTCTGACTTTTGGAAACTGG + Intergenic
1173056457 20:39618319-39618341 ACACACTGGATTTTGAAGACAGG - Intergenic
1173397351 20:42691766-42691788 GAATCATGGCTTTTGGAGACAGG - Intronic
1173700582 20:45067507-45067529 AAACCCTGTACTTTGGATATGGG + Intronic
1174385485 20:50186471-50186493 AGATCCAGGATTTTGGAGACGGG - Intergenic
1174836440 20:53860022-53860044 AACCTCTGCCTTTTGGAGACAGG + Intergenic
1176659331 21:9619303-9619325 AATCCCTGAGTTTTGGAGGCAGG - Intergenic
1177336528 21:19735552-19735574 GAACCCTGGAAGTTTGAGACAGG + Intergenic
1178249143 21:30985389-30985411 AGAACCTGGAGTTTGGAGAGAGG - Intergenic
1178582031 21:33845764-33845786 AAAGCCTGGACTTTCGTGACGGG - Intronic
1180916676 22:19493692-19493714 AATCCCAGCACTTTGGAGACAGG - Intronic
1181834259 22:25589585-25589607 TAACCCTGGACTCTGGAGGCCGG + Intronic
1182026641 22:27124410-27124432 AATCACTGGCTTTTGGAGAGAGG + Intergenic
1182503519 22:30765634-30765656 AAAACATGGAATTTGGAGATGGG - Intronic
949296078 3:2524949-2524971 AAACTCTGGATTTTAGAGACAGG - Intronic
949357526 3:3197761-3197783 AAACCCTGGATTATACAGATGGG - Intergenic
949699162 3:6736076-6736098 AAACCCTGAATATCTGAGACAGG + Intergenic
950515436 3:13461870-13461892 AAACACTGGATTTAGGACCCTGG - Intergenic
950663252 3:14479960-14479982 ATTCCTTGGATTTAGGAGACAGG + Intronic
951356970 3:21679108-21679130 AAACACTGGAATTTGGATGCAGG - Intronic
952271256 3:31834154-31834176 AAAACCTGGAGATTGTAGACAGG - Intronic
952281378 3:31926522-31926544 AAATTCTGGAATATGGAGACAGG + Intronic
952400745 3:32961017-32961039 ACAACGGGGATTTTGGAGACAGG - Intergenic
953056956 3:39395728-39395750 AAACCCTGGATCCTGGATCCAGG - Intronic
954905894 3:54062549-54062571 AAACTATGGATTTTAGAGAGTGG - Intergenic
955334952 3:58077579-58077601 AGACACAGGATTTTGGAGTCTGG - Intronic
955336709 3:58092845-58092867 AATCCATAGATTTTGGTGACCGG - Intronic
955663307 3:61324339-61324361 ACACCCTGGGTTTTAGAGAAGGG - Intergenic
955734471 3:62022624-62022646 GAACCCTGGTTTTTGGTGATAGG + Intronic
956202569 3:66721448-66721470 AAACACTGAATCTTGGAGTCAGG - Intergenic
956673661 3:71715032-71715054 CACCCCTGGACTGTGGAGACAGG - Intronic
956861409 3:73327527-73327549 AAAAGCTGCATTTTAGAGACAGG - Intergenic
958452296 3:94288939-94288961 AAAGCCTAGATTTTTGAGATTGG + Intergenic
959580829 3:107980723-107980745 AGACACTGAATTTGGGAGACTGG - Intergenic
962652927 3:137514530-137514552 AAACCCCCAATATTGGAGACAGG + Intergenic
963302932 3:143618958-143618980 AAACCCTGCATTTTGAAAATTGG + Intronic
964567733 3:158075975-158075997 AGACCATGGAGTTTGGAGTCAGG - Intergenic
964859728 3:161187891-161187913 AAGCCCAGGAGTTTGGAGGCTGG - Intronic
964960317 3:162414642-162414664 AGACCTTGCATTTTGAAGACAGG + Intergenic
965331628 3:167381263-167381285 TAAGTCTGGATTTTGGAGTCAGG + Intronic
965345992 3:167550816-167550838 AAATCATAGATTTTGGAGGCAGG + Intronic
965614557 3:170580381-170580403 AAGACCTGGATTTTGGAAAGGGG - Intronic
965900517 3:173634943-173634965 AATCCCTGCATTGTGGAGAAGGG - Intronic
966667144 3:182484252-182484274 AAAACCTGGTCTTTGGGGACAGG - Intergenic
968902261 4:3437274-3437296 AAACACTTGTTTCTGGAGACAGG - Intronic
969931551 4:10635830-10635852 AGAACACGGATTTTGGAGACAGG - Intronic
970163522 4:13213022-13213044 AACCCCTGGGCTTGGGAGACAGG - Intergenic
970244673 4:14047766-14047788 AAAGTCTGCATTTTGGAGGCAGG - Intergenic
970509645 4:16768679-16768701 AGACCCTTGGTTTTGGAGAAAGG - Intronic
972878237 4:43392586-43392608 AGGCCCTGGATATTGGAGGCTGG - Intergenic
974183678 4:58417591-58417613 AAAACCTGGATTATGCAGACAGG + Intergenic
976854345 4:89584969-89584991 AAACCCTGGTTTTTGTAAAAAGG + Intergenic
977876230 4:102153892-102153914 TAACCATGAATTTAGGAGACAGG - Intergenic
978067580 4:104424559-104424581 CAAACATGCATTTTGGAGACTGG - Intergenic
978700075 4:111632338-111632360 AATCCCTTGATTTAGGCGACAGG - Intergenic
979143822 4:117214913-117214935 ATACATTGGACTTTGGAGACTGG - Intergenic
981326291 4:143451680-143451702 GAACCCTGGATTTGGAAAACTGG - Intronic
981575691 4:146202736-146202758 AAACCCAGGATGGAGGAGACAGG - Intergenic
984191628 4:176612970-176612992 GAACCCTGGATGCTGTAGACTGG + Intergenic
985124372 4:186677472-186677494 AAACCCTGAATTTAGAAAACGGG - Intronic
985416174 4:189737894-189737916 AATCCCTGAGTTTTGGAGGCAGG + Intergenic
986180643 5:5390269-5390291 AAAGCCTGTGTCTTGGAGACAGG + Intergenic
987707492 5:21474268-21474290 AAAGCCTGTGTCTTGGAGACAGG - Intergenic
988090937 5:26541002-26541024 AAACTCTGGGTGTTGGAGAAGGG - Intergenic
988856689 5:35233968-35233990 AAACCCCGGCTTTTAGAGCCAGG - Intergenic
989097825 5:37797267-37797289 AGACCTTGGATTTTGGAGCAAGG + Intergenic
989417319 5:41194977-41194999 AAAGCCTGGGTTTTGAAGTCTGG + Intronic
991165879 5:63565140-63565162 AAAACCTGGATATGGAAGACTGG - Intergenic
991258740 5:64644082-64644104 AGAGCATGGATTTTGGAGCCAGG + Intergenic
991551311 5:67839358-67839380 AAACCTTGTTTTTTAGAGACAGG - Intergenic
991649805 5:68840265-68840287 AAACCCTGGAATCTGAATACAGG - Intergenic
992446692 5:76840527-76840549 GAACCCTGAATATTTGAGACAGG - Intergenic
994059885 5:95463034-95463056 AAACCCAGGTTTTTCTAGACTGG - Intergenic
994776289 5:104038945-104038967 GAACCCTGACTATTGGAGACAGG - Intergenic
996090816 5:119349927-119349949 AAAGTCTGGATATAGGAGACAGG + Intronic
997483442 5:134207447-134207469 AAAGTCAGAATTTTGGAGACTGG + Intronic
998669539 5:144338313-144338335 AGAACATGGATTTTGGAGACTGG + Intronic
999292655 5:150436828-150436850 AATCCCGGCATTTTGGAGGCTGG + Intergenic
999421886 5:151451487-151451509 AAACTCTGGATTGTGAAGCCAGG - Intronic
1000208545 5:159087491-159087513 AAAGCTTGGTTTTTGGAGGCAGG + Intronic
1002519556 5:179783949-179783971 AAAACCTTTTTTTTGGAGACAGG - Intronic
1003442031 6:6151788-6151810 AAACCTTGGGTTGGGGAGACCGG - Intronic
1008479076 6:51966081-51966103 AAACCCTGAATATCTGAGACAGG + Intronic
1009020731 6:57946244-57946266 AAAGCCTGTGTCTTGGAGACAGG + Intergenic
1009785901 6:68338922-68338944 AAACCCTGATTTTTGGGGAGTGG + Intergenic
1013170429 6:107633551-107633573 AATACCTGGATTTTGGGGACGGG + Exonic
1013198977 6:107873487-107873509 AAAATCTGGATTTTGGAGATTGG - Intronic
1014800066 6:125768914-125768936 AAACCATTGCTTTTGAAGACAGG - Intergenic
1015345323 6:132150229-132150251 AAACCATGGTGTTTGGAGATGGG - Intergenic
1015837709 6:137439669-137439691 ACACCCTGCATTTGGGAGGCAGG - Intergenic
1018001473 6:159582293-159582315 AGAAACTGGATTTTGGAGAAGGG + Intergenic
1018620038 6:165721308-165721330 AAATCCTGGATTTTGGTGTTTGG + Intronic
1019004360 6:168783953-168783975 AAATCCTGGATTTGGGGGAAGGG + Intergenic
1020238689 7:6375340-6375362 AATCCCAGCATTTTGGAGGCTGG - Intronic
1020931949 7:14408251-14408273 AAACCCTAGGTGTTGGAGGCAGG + Intronic
1021602269 7:22376179-22376201 AAACCATGGATTTATGCGACAGG + Intergenic
1022574640 7:31485923-31485945 ATACATTGGATTTTGGGGACTGG + Intergenic
1022598325 7:31733542-31733564 AAAGCCTGGATTCTGATGACAGG - Intergenic
1022750951 7:33225060-33225082 CAACCCTGAATTTTGAAAACAGG - Intronic
1024938850 7:54741075-54741097 GAACCCTGAACTTTTGAGACAGG - Intergenic
1025028359 7:55536182-55536204 ACACCCTGAAGTATGGAGACTGG + Intronic
1026930573 7:74220940-74220962 TAACCCTGGGTTTGGGGGACTGG + Intronic
1028384942 7:90244423-90244445 CACCCCTGGTTTTTTGAGACAGG - Intergenic
1029470494 7:100751458-100751480 ATACCATGGATTTTGGGGGCTGG + Intronic
1031675493 7:124606332-124606354 AAACCTAGGCTTTTGGAGAGAGG + Intergenic
1032149517 7:129416056-129416078 AAACCCTGGATTTTGTGCACTGG - Intronic
1034486974 7:151371919-151371941 GAACCCAGGAGTTTTGAGACTGG - Intronic
1034753028 7:153588412-153588434 AAACAATGGATTTGGGAGTCAGG + Intergenic
1035092135 7:156321896-156321918 AGAACCTGGAATTTGGAGTCAGG + Intergenic
1035268423 7:157705327-157705349 AAACCCTCCATTTTCCAGACAGG + Intronic
1035269182 7:157709973-157709995 AAACCGTGGATGCTGGAGAGAGG + Intronic
1035982066 8:4383513-4383535 AAGCCCTGGCTATTGCAGACAGG + Intronic
1036670136 8:10778103-10778125 AAACCCTGGTCTTTGGGGGCTGG + Intronic
1036678975 8:10856826-10856848 GAACCCTGGGCTTTGGAGACGGG + Intergenic
1036983451 8:13498142-13498164 AAACCCTGCATTTTTGACACTGG - Intronic
1037630103 8:20647971-20647993 AGAGCCTGGAGTTTGGAGTCAGG + Intergenic
1037996215 8:23354230-23354252 AACCCCTGGAGATTGGGGACAGG - Intronic
1040538394 8:48329554-48329576 GAACCATGGAATTTTGAGACTGG - Intergenic
1041985832 8:63921774-63921796 AAAACCTGGATTTTGGAATAGGG + Intergenic
1042312324 8:67391474-67391496 AATCCCTGTACTTTGGAGGCAGG + Intergenic
1042714550 8:71758495-71758517 AGAGCCTGGACTTTGGAGCCAGG + Intergenic
1042863663 8:73337895-73337917 GAACCCTGGCTTTTAGAGAAGGG + Intergenic
1043808772 8:84707881-84707903 ATGCCCTGGATTTTGGTGATGGG - Intronic
1043813214 8:84768468-84768490 AAAACCTGGTTTTAGTAGACAGG - Intronic
1044330398 8:90913556-90913578 AAAACCTGTATTTGAGAGACTGG - Intronic
1044394061 8:91688550-91688572 TTACCCTGGATGTTGGAGATGGG + Intergenic
1044630185 8:94270905-94270927 AGACCATAGATTTGGGAGACAGG - Intergenic
1045952581 8:107867906-107867928 AAACACAGAATTTTGGAAACAGG - Intergenic
1047929671 8:129714067-129714089 AAACCCGGGATGCTGCAGACAGG + Intergenic
1048330512 8:133467609-133467631 AGACCCTGGATTTTGGGGTAGGG + Intronic
1050774199 9:9239640-9239662 AAGCCCTGGATTTTGGGATCTGG + Intronic
1050912671 9:11092618-11092640 ATAGCCTGGATTTTAGAGACTGG - Intergenic
1052634234 9:31080729-31080751 AACCCCTGGCTTTTGGTAACAGG - Intergenic
1054987602 9:71280541-71280563 AAGCCCTGGATTTTTGAGAGAGG + Intronic
1055527069 9:77145765-77145787 AAAGCCTGGATGTGGGAGCCAGG - Intergenic
1055889608 9:81108614-81108636 AAACTCAGGAAGTTGGAGACAGG + Intergenic
1057930652 9:99190254-99190276 AAACACTGGCATTTGGAGCCTGG + Intergenic
1058529496 9:105891560-105891582 AGAACATGGAATTTGGAGACAGG - Intergenic
1203636893 Un_KI270750v1:121146-121168 AATCCCTGAGTTTTGGAGGCAGG - Intergenic
1185476022 X:416149-416171 AATCCCTGGATTATGGAAAACGG - Intergenic
1186156232 X:6729530-6729552 GAACCCCGGATATTTGAGACAGG - Intergenic
1188205614 X:27354136-27354158 AAACTCTGAATGGTGGAGACAGG + Intergenic
1188488518 X:30710285-30710307 CAACACTGGACTTGGGAGACTGG - Intronic
1188703268 X:33292598-33292620 CAATCCTGGATTTTGGATTCTGG + Intronic
1188782001 X:34296802-34296824 AATGACTGGATTTTAGAGACAGG + Intergenic
1189337303 X:40177619-40177641 AAACACTGGGTTTTGTAGACAGG - Intergenic
1190329215 X:49225524-49225546 AGAGCCTGGATTCTGGAGCCAGG + Intronic
1190397221 X:49997529-49997551 AAACTCTTGTTTTTTGAGACAGG + Intronic
1190956583 X:55201040-55201062 AAACCCCGAATACTGGAGACAGG + Intronic
1192113241 X:68386603-68386625 AGACCCTAGAGTTTGGATACTGG - Intronic
1194101000 X:89703947-89703969 AAACTCTTTTTTTTGGAGACAGG + Intergenic
1194553579 X:95330983-95331005 AAAGCCTGGCATTTGGAGAGGGG + Intergenic
1198832748 X:140768116-140768138 AAAACATGGATATTGGAGTCTGG + Intergenic
1199573430 X:149290417-149290439 AAGGCCTGGACTTTGGAGTCAGG - Intergenic
1200453954 Y:3365032-3365054 AAACTCTTTTTTTTGGAGACAGG + Intergenic
1200776827 Y:7176908-7176930 AAACTCTGGAGTTGGGTGACAGG + Intergenic
1201862505 Y:18615013-18615035 AAGCCCTGGCTCTTGGAGTCTGG + Intergenic
1201870818 Y:18705367-18705389 AAGCCCTGGCTCTTGGAGTCTGG - Intergenic
1202379314 Y:24261815-24261837 ACACTCTGGAGTCTGGAGACAGG + Intergenic
1202491468 Y:25408306-25408328 ACACTCTGGAGTCTGGAGACAGG - Intergenic