ID: 1069901081

View in Genome Browser
Species Human (GRCh38)
Location 10:71707068-71707090
Sequence CCCAGGAGGCCTGCACAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 277}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069901081_1069901090 3 Left 1069901081 10:71707068-71707090 CCCACCTGTGCAGGCCTCCTGGG 0: 1
1: 0
2: 2
3: 40
4: 277
Right 1069901090 10:71707094-71707116 CTGCCTCCACCCCTCCCAGATGG 0: 1
1: 0
2: 3
3: 69
4: 520
1069901081_1069901101 22 Left 1069901081 10:71707068-71707090 CCCACCTGTGCAGGCCTCCTGGG 0: 1
1: 0
2: 2
3: 40
4: 277
Right 1069901101 10:71707113-71707135 ATGGACAGCCAGACTAGGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 123
1069901081_1069901103 27 Left 1069901081 10:71707068-71707090 CCCACCTGTGCAGGCCTCCTGGG 0: 1
1: 0
2: 2
3: 40
4: 277
Right 1069901103 10:71707118-71707140 CAGCCAGACTAGGTGGGGGCAGG 0: 1
1: 0
2: 2
3: 31
4: 409
1069901081_1069901099 20 Left 1069901081 10:71707068-71707090 CCCACCTGTGCAGGCCTCCTGGG 0: 1
1: 0
2: 2
3: 40
4: 277
Right 1069901099 10:71707111-71707133 AGATGGACAGCCAGACTAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 174
1069901081_1069901097 17 Left 1069901081 10:71707068-71707090 CCCACCTGTGCAGGCCTCCTGGG 0: 1
1: 0
2: 2
3: 40
4: 277
Right 1069901097 10:71707108-71707130 CCCAGATGGACAGCCAGACTAGG 0: 1
1: 0
2: 1
3: 20
4: 189
1069901081_1069901100 21 Left 1069901081 10:71707068-71707090 CCCACCTGTGCAGGCCTCCTGGG 0: 1
1: 0
2: 2
3: 40
4: 277
Right 1069901100 10:71707112-71707134 GATGGACAGCCAGACTAGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 96
1069901081_1069901102 23 Left 1069901081 10:71707068-71707090 CCCACCTGTGCAGGCCTCCTGGG 0: 1
1: 0
2: 2
3: 40
4: 277
Right 1069901102 10:71707114-71707136 TGGACAGCCAGACTAGGTGGGGG 0: 1
1: 0
2: 0
3: 18
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069901081 Original CRISPR CCCAGGAGGCCTGCACAGGT GGG (reversed) Intronic
900431154 1:2603847-2603869 CACAGGAGGCCGGCACTGGCCGG - Intronic
901802958 1:11719722-11719744 CCCAGGAGGTTTGCACAAGCCGG + Exonic
902396993 1:16137804-16137826 CCTATGGGGCCTGCCCAGGTGGG - Intronic
902466930 1:16624226-16624248 CCCAGGAGGACCGCCCAGGGCGG + Intergenic
902818489 1:18929407-18929429 CCCAGAGGGCCAGGACAGGTTGG - Intronic
903374859 1:22859384-22859406 CCCAGGGGCCCTGCAGAGTTTGG + Intronic
903376719 1:22870958-22870980 CCCAGGTTGCTGGCACAGGTAGG + Intronic
903647298 1:24903026-24903048 CCCAGCAGCCCTGCCCAGGCAGG + Intronic
905095488 1:35466554-35466576 CTCAGGAGTCCTGCAGAGGGAGG + Intronic
906614576 1:47225595-47225617 CCCGGGAGGTCTGCACAGCTCGG + Exonic
906700424 1:47853422-47853444 CCCAGCAGGTCTCCACAGGGTGG + Intronic
906812591 1:48844135-48844157 CCCAGGAGGCTGGAGCAGGTGGG - Intronic
907893183 1:58656121-58656143 CAGAGGAGACCTGCTCAGGTTGG + Exonic
916296713 1:163228011-163228033 CCCAGGATGCTTTCACAGGGGGG + Intronic
916662833 1:166937733-166937755 CCCTGGAGGCCTGGACAGACTGG + Intronic
917789961 1:178493217-178493239 ACCAGGAGGCCTGCAAAGGGAGG - Intergenic
919938892 1:202272943-202272965 CCTAGGTGTCCTGCCCAGGTGGG - Intronic
920915649 1:210256058-210256080 CCGAGGAGGCCTGCCCACGATGG - Intergenic
922425092 1:225484978-225485000 CCCAGGAGGCCTGCTCACCTCGG + Intergenic
923259124 1:232249998-232250020 CCCAGGAAGCCTGTAGATGTAGG + Intergenic
923555116 1:234994191-234994213 CCCTGGAGGCCTTCAAAGCTGGG + Intergenic
1063112047 10:3046243-3046265 CCCGGGAGGCCAGGACAGATGGG - Intergenic
1064182886 10:13134659-13134681 CCCAGGAGATCTGCCCACGTCGG + Intronic
1065122794 10:22544764-22544786 CCCAGGAGGCCTGGAGAGCTTGG + Intronic
1067559943 10:47298315-47298337 CGCAGGAGGCCCGCACAAGCTGG - Intergenic
1069901081 10:71707068-71707090 CCCAGGAGGCCTGCACAGGTGGG - Intronic
1069967640 10:72134515-72134537 CCCATGTGGCCTTCACAGCTTGG + Intronic
1069967802 10:72135931-72135953 CCCATGTGGCCTTCACAGCTTGG - Intronic
1070370425 10:75777162-75777184 CCCACCAGCCCTGCACAGCTCGG - Intronic
1070956024 10:80464256-80464278 CCAAGGCGGCCTGAACAGGGAGG - Intronic
1070977231 10:80614948-80614970 CCCAGGAGGGCTACCCAGGAGGG - Intronic
1071026906 10:81125638-81125660 CCCAGGACACCTGCACTGGCTGG + Intergenic
1073215225 10:101832589-101832611 CCCAGGAGCCATGGAGAGGTGGG + Intronic
1073575837 10:104622484-104622506 CCCAGCAGGGATGCACAGGGTGG - Intergenic
1074192711 10:111151531-111151553 CCCTGGTGGCGTTCACAGGTTGG + Intergenic
1075397867 10:122141017-122141039 CCCAGGAGTCCTGCTCAGAGAGG + Intronic
1075726487 10:124613350-124613372 CCCAGGAGGCCATCACTTGTCGG - Exonic
1075738422 10:124678498-124678520 ACCAGAAGGCCTCCAGAGGTGGG - Intronic
1076093683 10:127712929-127712951 TCCTGGAGCCCTGCACAGGATGG - Intergenic
1076242714 10:128921772-128921794 CACAGGATGCCTGCACAGCATGG + Intergenic
1076383570 10:130041020-130041042 TCCAGGAGGCCCTGACAGGTGGG + Intergenic
1077309087 11:1880602-1880624 CCCAGGAGGCCTCCGCGGCTGGG + Intronic
1077367510 11:2167125-2167147 CCCAAGAGGCCTGCGTTGGTAGG - Intronic
1077553630 11:3215437-3215459 ACCTGGAGGTCTGCAGAGGTGGG + Intergenic
1077870608 11:6259126-6259148 CCAAGGAGCCCTCCACAGCTGGG - Intergenic
1079106066 11:17573231-17573253 CCCATGGCGCCGGCACAGGTGGG - Exonic
1083655095 11:64225739-64225761 CCCAGGGAGCCTGGACTGGTGGG + Intronic
1083677181 11:64332630-64332652 CCAAGGAGGCCAGGGCAGGTGGG - Intergenic
1083811232 11:65108069-65108091 CCCAGGAGCCGGGCACAGATGGG - Intronic
1083815852 11:65132128-65132150 CCTTGGTGGCCAGCACAGGTTGG + Intronic
1084085823 11:66854752-66854774 ACCTGGAGGCCTGGACAGGAAGG + Intronic
1084914959 11:72421699-72421721 CCCAGAAGCCCTGCAGAGGCAGG - Intronic
1085390434 11:76179377-76179399 CCCAGGGGACCTGCACAGGAGGG - Intergenic
1086605621 11:88692849-88692871 TCCTGGAGGCCTGCACAGGGTGG + Intronic
1088248270 11:107840184-107840206 TCCAGGAGGGCTGAAAAGGTGGG + Intronic
1088977328 11:114827498-114827520 CCCAGGAAGTCAGCACAGGATGG - Intergenic
1089741904 11:120590274-120590296 CCCAGGAGGCCTCCACCTGCAGG + Intronic
1090113697 11:123943391-123943413 GCCAGGAGGCCAGCACTAGTTGG + Exonic
1090849594 11:130560640-130560662 CCCATGAGGACTGCACACGATGG - Intergenic
1091817041 12:3446501-3446523 CTCAGAAGGCCTGTGCAGGTTGG - Intronic
1092010639 12:5108821-5108843 CACTGGAGGCTTGCAAAGGTGGG + Intergenic
1095557393 12:43523501-43523523 CCCAGGTTGCCTGCACAGCTGGG - Intronic
1095867027 12:46983496-46983518 CACAGGATCCCTGCACAGGAAGG - Intergenic
1097916037 12:65021417-65021439 CCAAGCAGGCCTCCACAGGTGGG - Intergenic
1098371771 12:69767797-69767819 CCCAGGATCTCTGCACAGGAAGG + Intronic
1099959610 12:89384107-89384129 CCCAGCAGGACTGCAAGGGTGGG + Intergenic
1102260582 12:111440814-111440836 CTCAGGAGGGCTGCCCAGGGAGG + Intronic
1102465535 12:113129063-113129085 CCCTGGAGCCCAGCACAGGCTGG - Intronic
1102651265 12:114444178-114444200 CCCAGGAGGCATACAAACGTGGG - Intergenic
1103739873 12:123083961-123083983 CCCAGCAGGCTTGCTGAGGTTGG - Intronic
1104584628 12:130038130-130038152 CCCAGGAGGCCAGCCACGGTGGG - Intergenic
1104775097 12:131386154-131386176 CCCAAGAGACCTGCAGAGGCCGG + Intergenic
1105304211 13:19157829-19157851 CCCAGGAGGGCTGCAAAGCTGGG - Intergenic
1107686540 13:42906102-42906124 CCCAGGAGGGCTGCTCTGCTGGG + Intronic
1114979644 14:28147154-28147176 CCCAGGAAGCTTGTACAGGTGGG - Intergenic
1116949450 14:50865603-50865625 CCCAGGAGACTTGGACAGGATGG - Intronic
1119436470 14:74600788-74600810 CTCAGGAGGCCTGGGCAGGAGGG - Intronic
1121975078 14:98395989-98396011 CCCAGGAGCCCTATAAAGGTGGG - Intergenic
1122965034 14:105119480-105119502 CCCAAGACGCCTGAACAGGCAGG + Intergenic
1123014928 14:105369068-105369090 CCAGGGAGGCCAGCGCAGGTGGG + Intronic
1123927683 15:25134349-25134371 CCCTGGAAGCCTGCACAGAAAGG - Intergenic
1124439826 15:29677845-29677867 GACAGGAGGCCTGCTCTGGTGGG + Intergenic
1124937431 15:34186362-34186384 AGCAGGAGCCCTGCCCAGGTGGG + Intronic
1126050676 15:44682279-44682301 TCCAGGAGGCCTTCTCAGATAGG + Intronic
1128765936 15:70251135-70251157 CCCAGGAGTCCTGCATAGGCCGG + Intergenic
1128943403 15:71806487-71806509 CCCAGGAGGTCTGGGCCGGTTGG - Intronic
1129708504 15:77808212-77808234 CACTGGAGGCCTGCACAGCCCGG + Intronic
1130298683 15:82664518-82664540 CCAAGGAGGCCTGCATATGAGGG - Intronic
1132700407 16:1219860-1219882 CCCAGGGGACCTGCCCAGTTTGG + Intronic
1133042052 16:3066052-3066074 CCCAGGAGCCCTTCACAGCCCGG + Intronic
1134320083 16:13154898-13154920 CCCAAGAAGCCTGCAGAGATGGG + Intronic
1136748949 16:32615952-32615974 CCCAGGAGGCCTGAACTGGGGGG - Intergenic
1137001748 16:35235251-35235273 CCCAGGTGGCCCTCACAGGTGGG + Intergenic
1137043955 16:35639262-35639284 CCCAGGAGACCTGAAAAGTTAGG - Intergenic
1137864082 16:51875812-51875834 CCCCAGAGGCCCGGACAGGTAGG - Intergenic
1138473849 16:57259096-57259118 CCCAGGAGGCCTGCTGAGCAGGG + Intronic
1138577257 16:57915956-57915978 CCCAGGAGACCAGCACAGGCTGG - Intronic
1139401160 16:66682680-66682702 TCCATGAGGCCTGCAAAGGGAGG - Intronic
1141033310 16:80608176-80608198 CCCAGGAGGCCTGCAGCAGGGGG - Exonic
1141163017 16:81641654-81641676 CACAGGAGGCCACCACCGGTGGG + Intronic
1142139960 16:88468479-88468501 GCCAAGAGGCCGGCACAGCTGGG - Intronic
1142151072 16:88512794-88512816 CCCCCGAGGCCTGGCCAGGTGGG + Intronic
1142245573 16:88968696-88968718 CCAAGGGGGCCTGCAGTGGTGGG - Intronic
1203051082 16_KI270728v1_random:875166-875188 CCCAGGAGGCCTGAACTGGGGGG - Intergenic
1142520801 17:503251-503273 CCCAGGAAGCCCGCACCGGCGGG - Intergenic
1142594613 17:1023388-1023410 TCCAGGCTGCCTGCACAGGGAGG - Intronic
1142740666 17:1930162-1930184 TGCTGGAGGCCTACACAGGTAGG - Intergenic
1143341380 17:6213997-6214019 CCCAGGAGGCCAGCATGGGGAGG + Intergenic
1143575000 17:7787052-7787074 TCCTGGAGGCCTGCAGAGGCAGG + Intronic
1143770093 17:9162984-9163006 ACCGGAAGGCCTGCAAAGGTGGG + Exonic
1144626720 17:16847676-16847698 CCCAGGAGGCCTCCTCAGTGAGG + Intergenic
1144765221 17:17728890-17728912 CCCAGGGGTCCTGCAGAGGTAGG - Intronic
1144879712 17:18425034-18425056 CCCAGGAGGCCTCCTCAGTGAGG - Intergenic
1144941919 17:18947997-18948019 ACCAGGCGTCCAGCACAGGTGGG - Intergenic
1145139067 17:20436992-20437014 CCTTGGAGGCCTGCAGAGCTGGG - Intergenic
1145152523 17:20519351-20519373 CCCAGGAGGCCTCCTCAGTGAGG + Intergenic
1145755110 17:27384685-27384707 CCCAGGAGGCTTGGATAGGGAGG - Intergenic
1145794758 17:27649226-27649248 CCCAGGAGGCAGGCACAGCCAGG + Exonic
1145909342 17:28533515-28533537 CCCAGGGGGCGTGCCCTGGTGGG - Intronic
1146163853 17:30573512-30573534 CCCAGGAGGCCTCCTCAGTGAGG + Intergenic
1146920423 17:36706330-36706352 CCCAAGAGGGCAGCACAGGTGGG + Intergenic
1147580862 17:41626366-41626388 CCCAGGAGGCCTCCTCAGTGAGG + Intergenic
1148674893 17:49439402-49439424 ATCAGGAGGACTGCTCAGGTAGG - Intronic
1149296986 17:55269958-55269980 CCCAGGAGACCTGCACATATTGG + Intronic
1149310446 17:55387788-55387810 CCCAGGAGGCATGCTCAGGTTGG + Intergenic
1149581474 17:57753396-57753418 CCCAGGAAAACTGAACAGGTTGG + Intergenic
1151884874 17:76917689-76917711 CCCAAGGTCCCTGCACAGGTTGG + Intronic
1151956438 17:77382548-77382570 CCCAGGAGGCCTGGAGGGCTGGG + Intronic
1151973965 17:77474128-77474150 TCCAGGAGGCCGCCCCAGGTTGG - Intronic
1152230898 17:79113558-79113580 CCCAGGAAGCGTGTCCAGGTGGG - Intronic
1152351289 17:79785265-79785287 GCAAAGAGGCCTGCAGAGGTAGG - Exonic
1152908908 17:82985950-82985972 CCCAGGAGGGCTCCTCAGGAGGG + Intronic
1153947843 18:10032619-10032641 CCCGGAAGGCCTGCGCAGGTGGG + Intergenic
1156499031 18:37545290-37545312 CCCAGGACTCCTGGGCAGGTAGG + Intronic
1157393984 18:47326635-47326657 CACTGGAGGGCTGCACAGCTTGG + Intergenic
1157422854 18:47560597-47560619 CCCAGGAGTCCTGCAAGGGCAGG - Intergenic
1159561706 18:70001884-70001906 CCCAGGAGGACTGCAGACCTTGG - Intergenic
1161737743 19:6002008-6002030 CCCACGAGGCCTGCTCCTGTGGG + Exonic
1162003497 19:7763230-7763252 CCCAGGAGTCCTGAACATCTGGG + Exonic
1162837436 19:13330099-13330121 CCCAGGACACACGCACAGGTGGG + Intronic
1163300392 19:16441803-16441825 GGAAGGAGGCCTGCACAGGCTGG + Intronic
1163386062 19:17001396-17001418 CCAGGGAGGCCTGCAGAGGGCGG + Intronic
1163697839 19:18772908-18772930 CCCAGGTGGGCAGCCCAGGTGGG + Intronic
1164203638 19:23039911-23039933 TCCAGGAGGCCTGTACATGTGGG - Intergenic
1164478467 19:28593200-28593222 GCCAGGTGGCCAGCACAGGTGGG + Intergenic
1164730910 19:30503810-30503832 CCCAGGTGGCCTGCAAAGAGGGG - Intronic
1165069481 19:33247413-33247435 CCCAGGAGGCCAGCTGTGGTGGG + Intergenic
1165319689 19:35077534-35077556 CCCCGGAGGGCTGCATCGGTGGG - Intergenic
1165821840 19:38681692-38681714 CCCTGGAGGAGTGCACAGCTCGG - Intronic
1166304842 19:41931860-41931882 TCCAGGAGGGCTGCAGTGGTGGG - Intergenic
1166389199 19:42399598-42399620 TCCAGGAAGCCTGGGCAGGTGGG - Intergenic
1167100883 19:47403614-47403636 CTGATGAGGCCTGCACAGATGGG - Intronic
1168026094 19:53644587-53644609 CTCAGGAGTCCTACACAGCTGGG + Intergenic
925114923 2:1370196-1370218 CCCAGGAAGACTCCCCAGGTCGG - Intergenic
927432067 2:23035137-23035159 TGCAGGAGGCCTGCAGAGGGGGG - Intergenic
927561808 2:24078723-24078745 CCCAGGAGGCAGCCACAGATAGG + Intronic
928225350 2:29443604-29443626 CCCAGGAGGCCTGCACCCTAAGG - Intronic
928420095 2:31131711-31131733 CCCAGGATTCCTGCACAGCTTGG - Intronic
929103505 2:38340643-38340665 ACCTGTATGCCTGCACAGGTGGG - Intronic
929777915 2:44939844-44939866 CCAAGGAGGCTTGCACTTGTCGG + Intergenic
929795995 2:45058723-45058745 CCCAGGATGCCCACCCAGGTGGG + Intergenic
930201068 2:48552527-48552549 CCCAGGAGACCTGCCCACCTCGG - Intronic
933557874 2:83852740-83852762 CCCAGGAGACCTTCAGAGCTAGG - Intergenic
934615295 2:95766991-95767013 TCCAGGAGGCCTGTACGTGTGGG + Intergenic
934645611 2:96057568-96057590 TCCAGGAGGCCTGTACGTGTGGG - Intergenic
934839015 2:97613657-97613679 TCCAGGAGGCCTGTACGTGTGGG - Intergenic
937093734 2:119223195-119223217 CCCAGAAGGCCTAGACAGGGAGG + Intergenic
938242327 2:129752979-129753001 CTCAGGAGTTCTGCAAAGGTGGG + Intergenic
940637166 2:156312140-156312162 CCCTGGAAGCCTGCATATGTTGG + Intergenic
941474051 2:165926418-165926440 CACAGGAGACCAGCCCAGGTAGG - Intronic
942795731 2:179816535-179816557 CCCAGGAAGCCTAATCAGGTAGG - Intronic
944386062 2:199166079-199166101 CCCTGGAGGCCTGCACATCCTGG + Intergenic
945989305 2:216380315-216380337 TCCAAGAAGCCTGCACAGGCTGG - Intergenic
948095736 2:235332682-235332704 CCCCTGAGGCAGGCACAGGTAGG + Intergenic
948368091 2:237471720-237471742 CCCAGGAGGCCTTAAAAGGCAGG - Intergenic
948908398 2:240990953-240990975 CTCCTGAGGCCTCCACAGGTGGG + Intronic
948920440 2:241063782-241063804 CCCAGGTGGCCTGCCCAGCAGGG - Intronic
1169277870 20:4245734-4245756 CCCAGGAGCCCAGCACAGCTGGG + Intronic
1169344221 20:4817634-4817656 CAGAGGAGGCCTGGAGAGGTGGG - Intronic
1172162637 20:32879199-32879221 CACAGGTGGCCAGCACAGGCAGG + Intronic
1172182080 20:33009734-33009756 CAAAGGAGGCTTGCACAGGATGG - Intronic
1172844634 20:37922619-37922641 TCCAGGATGCCTGCAGAGATTGG - Intronic
1174367754 20:50066790-50066812 CCCAGGTCGTCTGCCCAGGTGGG + Intergenic
1175993830 20:62803610-62803632 CCCAGCAGGCCTGCAGGGCTAGG + Intergenic
1176127884 20:63484095-63484117 CCCTGGAGCCCTGCAAGGGTGGG - Intergenic
1176842332 21:13850964-13850986 CCCTGGAGGCCTGCTCAGTGGGG - Intergenic
1177275160 21:18901770-18901792 CCCAGGAGGCCAAGGCAGGTAGG - Intergenic
1178680829 21:34670579-34670601 CCCTGGAGGCCTCCCCATGTGGG - Exonic
1178828373 21:36034406-36034428 CCCAGGAGTTCTGAACAGCTTGG - Intergenic
1179006083 21:37516565-37516587 CCCAGTAGGCATCCACAGGCTGG - Intronic
1179230560 21:39500271-39500293 CCCAGGAGCCCTGCCCAGTGGGG + Intronic
1180783586 22:18535012-18535034 CTCACGAGCCCTGCCCAGGTGGG + Intergenic
1180842207 22:18964708-18964730 CCCAGGAGGCCGGCCATGGTGGG - Intergenic
1180975947 22:19848540-19848562 TCCAGGTTTCCTGCACAGGTAGG - Exonic
1181059292 22:20274173-20274195 CCCAGGAGGCCGGCCATGGTGGG + Intronic
1181127153 22:20709063-20709085 CTCACGAGCCCTGCCCAGGTGGG + Intronic
1181240488 22:21474364-21474386 CTCACGAGCCCTGCCCAGGTGGG + Intergenic
1181794242 22:25292873-25292895 CCCAGTAGGCCATGACAGGTAGG + Intergenic
1182447529 22:30398163-30398185 CCCAGGAAGGCTGGACAGGGAGG + Intronic
1182518116 22:30870359-30870381 ACCAAGAGGCCTGCACAGCCAGG - Intronic
1182985690 22:34714102-34714124 CTCAGAAGGCCTGTTCAGGTAGG + Intergenic
1183964916 22:41435782-41435804 CCGAGAAGGCCTGCTGAGGTTGG + Exonic
1184157072 22:42674879-42674901 CCCAGGAGACCCACACAGGGAGG - Intergenic
1184251467 22:43262715-43262737 ACCAGAAGGACTGCACACGTAGG - Exonic
1184476530 22:44725081-44725103 CCCTGCAGGTCTGGACAGGTGGG + Intronic
1184687057 22:46101005-46101027 CCCAGGTGGCCTCCACATGCAGG + Intronic
1184695084 22:46134462-46134484 CCCAGGAGGCCTGGGCAGCCAGG + Intergenic
1185292647 22:50034915-50034937 CACAGGAGGCCTGCACGGGCCGG - Intronic
950431823 3:12955319-12955341 CCCAGGAGGCCTGCCGGGCTGGG + Intronic
950473523 3:13201279-13201301 CCCAGGACTCCTGCCCAGCTTGG - Intergenic
950493909 3:13322397-13322419 TCCACCAGGCCTGCACAGGCTGG + Intronic
950621933 3:14212824-14212846 CCCAGGAGGCCAGGGCAGGTGGG + Intergenic
953033067 3:39190594-39190616 GCCATGAGGCCTGCAGGGGTAGG - Intronic
953976017 3:47382002-47382024 ACCAGGAGGCCGTCGCAGGTGGG + Intronic
954277485 3:49552151-49552173 CCCAGGAGACCTGAAAATGTGGG - Intergenic
954361976 3:50126861-50126883 CCCAGGAGACCTACACAGTCAGG - Intergenic
954392954 3:50276903-50276925 CCCGGGAGGGCGGCACAGGTCGG + Intronic
954615499 3:51967167-51967189 CCGCTGAGGCCTGCACAGGTGGG - Intronic
954894753 3:53965880-53965902 CCCAGGGGTCCTTCAGAGGTGGG + Intergenic
960090695 3:113635419-113635441 TCCATGAGGCCAGCACAGATTGG - Intergenic
960232067 3:115239920-115239942 CCCATCAGCCCTGCACAGCTAGG - Intergenic
961789933 3:129368419-129368441 CCCAGGACTCCTGCCCAGCTTGG + Intergenic
962546211 3:136438549-136438571 CACAGGTGGCCTGCTCAGGAAGG + Intronic
962914877 3:139892057-139892079 GCCAGGAGTCCTTCACAGGAAGG + Intergenic
964985375 3:162732068-162732090 TCCAGGAGGCCTGTACGTGTGGG - Intergenic
967174767 3:186853153-186853175 CCAAGGGGGCCTGCACAGGTTGG + Exonic
968909319 4:3469531-3469553 CCCAGGAGGCCTGGGCACCTGGG - Intronic
973772597 4:54220401-54220423 CCCAGGAGGCCTACCAAGGCTGG - Intronic
975719482 4:77236050-77236072 CACAGGACCCCTGCACAGATAGG - Intronic
979840039 4:125427013-125427035 CTCAGGAGGCAGGCAGAGGTAGG + Intronic
981327670 4:143469122-143469144 CCCGGGAAGCCTGGACAGATGGG + Exonic
985480363 5:106730-106752 CCCAGGGTGGCTGCACAGGCAGG + Intergenic
985731939 5:1554157-1554179 CCCAGGAGGCCTCCAGAGGCTGG + Intergenic
986659578 5:10046904-10046926 CTCAGGAGGTCTGCACAGGGAGG + Intergenic
987836285 5:23167597-23167619 CCCAGGATGTCTGCACAGTTGGG - Intergenic
988289910 5:29271222-29271244 TCCAGCAGACCTGCACAAGTGGG + Intergenic
989165608 5:38430995-38431017 TCCATGATGCCTGCCCAGGTTGG + Intronic
991571230 5:68055275-68055297 CACAGGACTCCTGCACAGGATGG + Intergenic
993371846 5:87102491-87102513 GCCATGAGGCCTGCACTGCTTGG + Intergenic
994245041 5:97468777-97468799 CAAAGAAGGCCTGCACATGTAGG + Intergenic
995953718 5:117748476-117748498 GCCATGAGGCCTGTACATGTGGG + Intergenic
998432515 5:142078413-142078435 GCCAGGTGGCCTGCTCATGTCGG + Intergenic
999252787 5:150192546-150192568 CCCAGGAGGCTGGCACAGTGAGG - Intronic
1001433346 5:171680720-171680742 CCCAGTGGGCATGCAGAGGTGGG - Intergenic
1001595586 5:172896765-172896787 CCCAGGAGGATTGCTCATGTCGG + Intronic
1001936715 5:175710619-175710641 TCCAGGAGGCCTGCAGAAGGTGG - Intergenic
1001990845 5:176114354-176114376 CCCAGGAGGCCTGAACCAGGGGG - Exonic
1002123142 5:177021533-177021555 CCCAGGAGGCCTGGATAACTGGG + Intronic
1002226029 5:177723786-177723808 CCCAGGAGGCCTGAACCAGGGGG + Exonic
1002267817 5:178047424-178047446 CCCAGGAGGCCTGAACCAGGGGG - Exonic
1002382639 5:178841263-178841285 CCCAGGAGCCCTGGCCAGGGTGG - Intergenic
1002400150 5:178987021-178987043 CCCAGGAGGCCAGCTCTGCTGGG - Intronic
1003431528 6:6043190-6043212 GCCAGGTGGGCAGCACAGGTGGG + Intergenic
1004106802 6:12673479-12673501 CCTAAAAGGACTGCACAGGTGGG + Intergenic
1004849324 6:19681078-19681100 CCCAGGCGGCCTGCTGAGGTGGG + Intergenic
1005031477 6:21512873-21512895 CCCAGGAGGGGTGCCCAGCTTGG + Intergenic
1005583381 6:27253360-27253382 CCCAGCAGGACAGCAGAGGTAGG - Intronic
1012250086 6:96970282-96970304 CCCAGAATTCCTGCACAAGTGGG + Intronic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1016943753 6:149508132-149508154 CTCAAGAGATCTGCACAGGTTGG + Intronic
1018959103 6:168434068-168434090 CCCAGGGGCCCTGGACAGGTAGG - Intergenic
1019016692 6:168885325-168885347 CCCAGGAGGCCTGCAGAGCCTGG + Intergenic
1019189897 6:170245795-170245817 ACCAGGAGGACTGCACAGCCAGG - Intergenic
1019301234 7:304519-304541 CCCAGCAGACGTGCACACGTGGG - Intergenic
1019357378 7:587714-587736 GCCAGGAGGGCTGCACAGGAGGG - Intronic
1019486678 7:1292655-1292677 CCCGGGAGGGCTGGACTGGTGGG + Intergenic
1019564693 7:1673551-1673573 CCCAGGAGGCTGGAAGAGGTGGG - Intergenic
1019733805 7:2640861-2640883 ACCTGGCTGCCTGCACAGGTGGG - Intronic
1019872730 7:3780603-3780625 CCCAACAAGCCTGCACAGGCAGG + Intronic
1022081934 7:27030987-27031009 CCTATCAGGCCTGCACATGTTGG - Intergenic
1022532272 7:31074467-31074489 GCGAGGAGGGCTGCAGAGGTCGG - Intronic
1024058653 7:45682438-45682460 CCCAGGAGGTGTGCACTGGCTGG + Intronic
1024623951 7:51188359-51188381 CCCAGCAGGCCTGCCCAGGGCGG + Intronic
1025057182 7:55774773-55774795 ACCAGGAGGCATTCACAGTTGGG - Intergenic
1027455469 7:78386085-78386107 CCCAGGAATGCTGCAGAGGTGGG - Intronic
1032795233 7:135270980-135271002 CCCAGGAAGCCTGGACAGCAAGG + Intergenic
1033536922 7:142320930-142320952 CTCAGGAGGCCTGCAAGGGGAGG + Intergenic
1034272728 7:149811214-149811236 CCCAGGAGGCTAACACAGGTGGG - Intergenic
1035219331 7:157396553-157396575 CCCAGGAGGCCTGGCCCTGTGGG + Intronic
1037917316 8:22780578-22780600 CCCAGGAGGCATCCTCTGGTGGG - Intronic
1038376410 8:27044534-27044556 CCCTAGAGACCTTCACAGGTGGG - Intergenic
1040349657 8:46551495-46551517 CCCAGGTGGTCTGTGCAGGTGGG - Intergenic
1040579157 8:48681995-48682017 CCCAGGAGGCCTCCTCATTTGGG - Intergenic
1043967388 8:86494643-86494665 TCTATGAGGCCTGCACAAGTTGG - Intronic
1044523005 8:93221621-93221643 AGCAGGAGGCCTGCACAGCTTGG - Intergenic
1045286460 8:100795971-100795993 CCCAGGAGGGCAGGAAAGGTGGG + Intergenic
1046262713 8:111790749-111790771 CACAGAAGGCCTCCAGAGGTAGG - Intergenic
1048376021 8:133822867-133822889 CCCAGGAGCCCTGCCCAAGAAGG - Intergenic
1049207483 8:141370259-141370281 CCAAGGGGGCCTGCGAAGGTGGG + Intergenic
1049254570 8:141606762-141606784 CTCAGGAGGCCAGGGCAGGTGGG - Intergenic
1049372840 8:142275950-142275972 CCCAGGGGGCTTGCAGAGATGGG - Intronic
1049496766 8:142939251-142939273 CCCAGGAGGCCAGCAGGGGCAGG + Intergenic
1049615760 8:143575239-143575261 CCCAGGAGCCCTGCACCGTGAGG - Exonic
1049710897 8:144062890-144062912 CCCAGGAGGCAGGCGGAGGTGGG - Intronic
1049779957 8:144424390-144424412 CCCAGGAGGCCTGCAGGGTTTGG - Intronic
1049850606 8:144828131-144828153 CCCAGGTCACCGGCACAGGTAGG - Intronic
1052576583 9:30299440-30299462 CCCAGCAGGCCGGCACTGCTGGG - Intergenic
1053276664 9:36788372-36788394 CCCAGGAGGCTTGCACAACAGGG - Intergenic
1054782504 9:69177973-69177995 CCCAGAAGACCTGCACAAGCTGG + Intronic
1056257740 9:84817330-84817352 CCAAAGTGGCCTTCACAGGTTGG - Intronic
1056692529 9:88820104-88820126 CCCAGGTGGCCTGCATACCTTGG - Intergenic
1056844539 9:90025697-90025719 CCCAGGAGAAATGCACAGGAAGG + Intergenic
1060958578 9:127662893-127662915 TCCAGGAGGGCTGGACAGGGAGG - Intronic
1061028584 9:128066551-128066573 CCCAGGCGGCGTGCATAAGTGGG - Intronic
1061767762 9:132892606-132892628 GGGAGGAGGCCTGCACAGGCTGG - Exonic
1061817209 9:133204638-133204660 CCCAGGAGGCCTGTCCAGCTTGG + Intergenic
1062005068 9:134234926-134234948 CCCAGGAGGCTTCCAGAGGGAGG - Intergenic
1062313727 9:135954580-135954602 CCCAGGAGGCAGGCACAGCACGG + Intronic
1062535878 9:137020894-137020916 CCCAGGGTGCCTGCACTGGCCGG - Exonic
1062619070 9:137411425-137411447 CCCAGGGAGCCTCCACAGGAAGG + Intronic
1185613094 X:1403613-1403635 GCCAGGGGGCCCACACAGGTAGG + Intronic
1187270526 X:17776033-17776055 GGCAGGAGGACTGCTCAGGTGGG + Intergenic
1188029562 X:25249144-25249166 CCCAGGAGGGCTGCATTGTTAGG + Intergenic
1188168631 X:26893042-26893064 TCCAGGTGGCATGCACAGGTGGG - Intergenic
1189308645 X:40005587-40005609 CCAAGGAGGCCTGCGCGGCTCGG - Intergenic
1190193813 X:48299739-48299761 CCCAAGAAGCCAGCAGAGGTAGG - Intergenic
1194384389 X:93235905-93235927 GCCAGGGGGCCTGCACTGCTGGG - Intergenic
1196750948 X:119116764-119116786 CCCAGGTGTCCTGCAGAGCTTGG + Intronic
1197718787 X:129730480-129730502 ACCAAGAGGCCTGCCGAGGTTGG + Intergenic
1200873626 Y:8128703-8128725 CACAGGAGGCCAGCACTGCTGGG + Intergenic