ID: 1069904153

View in Genome Browser
Species Human (GRCh38)
Location 10:71722630-71722652
Sequence GTCCTGGCCTTCCCTACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 320}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069904153_1069904160 16 Left 1069904153 10:71722630-71722652 CCAGGGGTAGGGAAGGCCAGGAC 0: 1
1: 0
2: 4
3: 31
4: 320
Right 1069904160 10:71722669-71722691 TAATTTCATATGCAGTGCTCAGG No data
1069904153_1069904163 21 Left 1069904153 10:71722630-71722652 CCAGGGGTAGGGAAGGCCAGGAC 0: 1
1: 0
2: 4
3: 31
4: 320
Right 1069904163 10:71722674-71722696 TCATATGCAGTGCTCAGGGAGGG No data
1069904153_1069904161 17 Left 1069904153 10:71722630-71722652 CCAGGGGTAGGGAAGGCCAGGAC 0: 1
1: 0
2: 4
3: 31
4: 320
Right 1069904161 10:71722670-71722692 AATTTCATATGCAGTGCTCAGGG No data
1069904153_1069904162 20 Left 1069904153 10:71722630-71722652 CCAGGGGTAGGGAAGGCCAGGAC 0: 1
1: 0
2: 4
3: 31
4: 320
Right 1069904162 10:71722673-71722695 TTCATATGCAGTGCTCAGGGAGG No data
1069904153_1069904164 28 Left 1069904153 10:71722630-71722652 CCAGGGGTAGGGAAGGCCAGGAC 0: 1
1: 0
2: 4
3: 31
4: 320
Right 1069904164 10:71722681-71722703 CAGTGCTCAGGGAGGGTCTTAGG No data
1069904153_1069904158 -10 Left 1069904153 10:71722630-71722652 CCAGGGGTAGGGAAGGCCAGGAC 0: 1
1: 0
2: 4
3: 31
4: 320
Right 1069904158 10:71722643-71722665 AGGCCAGGACATTGGAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069904153 Original CRISPR GTCCTGGCCTTCCCTACCCC TGG (reversed) Intronic
900160407 1:1220554-1220576 GTCTTGGCCTCCCCGACCTCAGG - Intronic
900432466 1:2609365-2609387 GTCCTGGCCTTCTCCACAGCCGG + Exonic
900495577 1:2974518-2974540 ATCCTGGCCTTCCCCAACCCAGG - Intergenic
900607919 1:3531980-3532002 GTCCTGTCCTCCCCTGGCCCAGG + Intronic
900959425 1:5909742-5909764 GGGCTGGCCTTGCCTCCCCCAGG - Intronic
901011638 1:6205893-6205915 GTCCTGGCCTCTCCTCCCCGCGG + Intronic
901624157 1:10614067-10614089 GTCCTGCCCCTCCCCACCCTGGG - Intronic
901643386 1:10704419-10704441 GGCCGGGCCTGCCCTACACCGGG + Intronic
901829797 1:11885488-11885510 AGCCTGACCCTCCCTACCCCAGG - Intergenic
901933635 1:12613536-12613558 GTCCTTCCCATCCCTAGCCCTGG - Intronic
902130056 1:14252475-14252497 GCCAGGGCCTTTCCTACCCCAGG + Intergenic
902817857 1:18926341-18926363 GCCCTGGCCATCCCTCCCCCTGG - Intronic
902838885 1:19063110-19063132 GCCCTGCCCTGCCCAACCCCAGG + Intergenic
903646114 1:24897397-24897419 GCCCTGCCCTCCCCTACCCACGG + Intergenic
904380166 1:30105188-30105210 GTCTTTGCCTTCCCTTCCCTTGG + Intergenic
904651273 1:32007722-32007744 GCCCTGGCCCTCCCTCCACCTGG + Intergenic
905528894 1:38660963-38660985 GTCATGGCCTCAGCTACCCCGGG + Intergenic
907325399 1:53634810-53634832 TTCGTGGGCTTCCATACCCCTGG - Intronic
909576314 1:77180675-77180697 GTCCTGCCTTTCCCTACCCACGG - Intronic
910163384 1:84298396-84298418 GTACTGGCCTTCCCCATTCCTGG + Exonic
910425487 1:87116420-87116442 GTCCTGGCCAAGCCCACCCCTGG - Intronic
911165793 1:94723523-94723545 GTCCAGGCCTTCCTTATCCTGGG + Intergenic
912625579 1:111202999-111203021 GTCCTGGTCTTCCCAGACCCTGG - Intronic
913233725 1:116762991-116763013 GGCCTGCCCTGCCCCACCCCGGG + Intronic
914241141 1:145853938-145853960 TTCCTGGCCTTACCAACTCCTGG - Intronic
914428675 1:147600378-147600400 GACCTGGCCCCCACTACCCCCGG - Intronic
914914585 1:151811290-151811312 GGCCTGGCCTCTTCTACCCCAGG + Intronic
914956257 1:152165297-152165319 TTCCTGGCCTTTCCTCACCCTGG + Intergenic
915430127 1:155860012-155860034 ATCCTGGACTTCCCCACCCTCGG - Intronic
915935210 1:160086381-160086403 GTCCTGGTCCTCCCTGCCCGGGG - Intronic
919586672 1:199448139-199448161 GTGCTCGCCATCCCTCCCCCCGG + Intergenic
919785176 1:201254135-201254157 GTCCGGGCCTTCTCTACCCTGGG - Intergenic
919913246 1:202124811-202124833 TTCCTGTCCTTCCCAACCCAGGG + Intronic
919924028 1:202183058-202183080 GTCCTGCCCTGCCCTCCCCTGGG - Intergenic
920092540 1:203464764-203464786 GTCCTGGGCTGCCTTTCCCCAGG + Intergenic
920347837 1:205317916-205317938 GTCCTGCCCTTCCCTTTCCTGGG - Intronic
921047760 1:211489754-211489776 TTCCTGGCCTTCCCCAGCCCTGG + Intronic
922582726 1:226710731-226710753 GTGGTGGCCATCCCTACCCCAGG - Intronic
923109424 1:230879484-230879506 TGCCTGGCCTTCCCAACTCCAGG + Intergenic
1063717847 10:8546355-8546377 GTGCTGGCCTTCTTTCCCCCAGG + Intergenic
1064093742 10:12407325-12407347 TTCCTGGAGTTCCCTTCCCCTGG - Intronic
1064192815 10:13222319-13222341 GTCCTGGCCTTCTCTCACCAGGG - Intronic
1066701811 10:38137574-38137596 GACCTGGCCTTCCAAACACCAGG - Intergenic
1066961776 10:42232507-42232529 GCCCTGGCCCTCCCTGGCCCTGG - Intergenic
1069750986 10:70744792-70744814 GCCCTGGCCCTCCCGACCCAAGG - Intronic
1069783752 10:70974888-70974910 GCTCAGGCATTCCCTACCCCTGG - Intergenic
1069866139 10:71504208-71504230 ATTCTGCCCTTCCCGACCCCTGG + Intronic
1069904153 10:71722630-71722652 GTCCTGGCCTTCCCTACCCCTGG - Intronic
1070151977 10:73811051-73811073 GTCCCGGCCTCCCCAAGCCCGGG - Intronic
1070785266 10:79158902-79158924 GTCCTGGCCTCCCCTCCCCCGGG + Intronic
1071392813 10:85192401-85192423 GTCCTGTCGTTCCCTTTCCCTGG - Intergenic
1074078925 10:110152367-110152389 GGCCTGGCGTCCCCTCCCCCAGG + Intergenic
1075658005 10:124174504-124174526 GTCCTGGCCTTTCCTAACCCTGG - Intergenic
1075734226 10:124654297-124654319 GGCCTGGCCCTCCCAACCCCTGG + Intronic
1076123330 10:127953681-127953703 GTCCTGGTCTTCTCTTCCTCTGG - Intronic
1076322827 10:129596095-129596117 GCCCTGCCCCTCCCTGCCCCAGG + Intronic
1076362562 10:129899605-129899627 GGCCTGGCCTTCCCTCCGGCTGG - Intronic
1076858121 10:133127403-133127425 GTCCTGGGCTTCCCCACCACAGG - Intronic
1077032295 11:474063-474085 GTCCTGTCCTCCCCTCCGCCTGG + Intronic
1077423250 11:2462768-2462790 CTCCAGGCCTTCCCTGCCCCCGG - Intronic
1077636344 11:3843902-3843924 GTCTTGGGCTTGCCTAGCCCTGG + Intergenic
1077972639 11:7211203-7211225 GCCCTGAACTTTCCTACCCCTGG + Intergenic
1078147721 11:8733182-8733204 GCCCTGCCGCTCCCTACCCCAGG - Intronic
1080293522 11:30698566-30698588 GTCCAGGGCTCCCCAACCCCTGG - Intergenic
1080564280 11:33493771-33493793 GCCCTGTCCTTCCCTAGCCAAGG + Intergenic
1082012765 11:47461522-47461544 GTCTTGGCCTGCTCTACCCAAGG - Intergenic
1083292426 11:61697323-61697345 GGCCAGGCCTTCCCTCGCCCTGG - Intronic
1083297462 11:61722768-61722790 GGCCTGGCCTTTCCTATCGCTGG - Intronic
1083879948 11:65543378-65543400 GACCTGTCCCTCCCTACCCCAGG - Intronic
1084326583 11:68403804-68403826 TTCCTGTCCTGCCCTTCCCCAGG - Intronic
1084872823 11:72109451-72109473 GCCCTGGCCTTCCCTAACTCTGG + Exonic
1086827526 11:91517946-91517968 GTCTTGGCCATTCCTTCCCCTGG - Intergenic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1088544668 11:110947403-110947425 AGCCTGCCCTTCCCTAGCCCAGG + Intergenic
1088944444 11:114495462-114495484 CTCATGGCCGCCCCTACCCCAGG + Intergenic
1089489385 11:118872367-118872389 CACCTGGCCTTACCTACCCAAGG - Intergenic
1089660537 11:119982563-119982585 GTCCAGGCTGTGCCTACCCCGGG + Intergenic
1090383582 11:126343692-126343714 GTCCTGGCCCCTCCTACTCCAGG + Intronic
1091344460 11:134843583-134843605 GCCCAGGCCTTCCTTGCCCCGGG + Intergenic
1091403716 12:196318-196340 GCCCTGGCCTCCACTTCCCCTGG + Intronic
1092084230 12:5742473-5742495 GTCATTTCCTACCCTACCCCTGG - Intronic
1092748715 12:11698136-11698158 TTCCTGTCCTTCCCTGCCACAGG + Intronic
1094526524 12:31234666-31234688 GTCCTCTCCTGCCCCACCCCCGG - Intergenic
1095833149 12:46608982-46609004 GTCCTGCCTTTCCCCAGCCCTGG - Intergenic
1098398317 12:70045737-70045759 GTCCTGCCCGTCCCTGCTCCTGG - Intergenic
1100690941 12:97037902-97037924 GTCCTGGCCCTGCCACCCCCCGG + Intergenic
1102506655 12:113388403-113388425 GTCCTGGCCTGCCCCAATCCAGG - Intronic
1103741541 12:123094757-123094779 AACCTGGCCTTCCCTGCCCTCGG - Intronic
1104917501 12:132273468-132273490 GTCCTGGGCTGCCCGCCCCCAGG - Intronic
1106160638 13:27198561-27198583 GTCCTGGCCTTCCATAGTGCTGG - Intergenic
1108922413 13:55692704-55692726 TGCCATGCCTTCCCTACCCCTGG + Intergenic
1109360072 13:61283577-61283599 ATCCTGTCCTTACCAACCCCTGG - Intergenic
1110944596 13:81396602-81396624 GTCCTCTCCTTTCCCACCCCAGG - Intergenic
1114705922 14:24726652-24726674 GTGCTGGTCGTCCCTCCCCCGGG - Intergenic
1115852753 14:37600278-37600300 GTCCTGACCTACCCTCGCCCAGG - Intronic
1117375281 14:55113515-55113537 CTCCTTCCCTTCCCTTCCCCTGG + Intergenic
1118747202 14:68782775-68782797 GTCCTGGCCTATCCCTCCCCTGG - Intergenic
1121226829 14:92327354-92327376 ATCCTGTCATTCCCTCCCCCAGG + Intronic
1121585006 14:95057348-95057370 GTTCTGGCCTTCATCACCCCAGG - Intergenic
1122030307 14:98907273-98907295 TTCCTGCCCTTCCCTCCCGCAGG - Intergenic
1122552051 14:102555528-102555550 GGCCTGGCCCTCGCTCCCCCGGG + Intergenic
1122955327 14:105067733-105067755 TTCCTGGCCTTGTCTCCCCCTGG - Intergenic
1122955699 14:105069924-105069946 GTCCTGGCCTCTCCCACCCCTGG + Intergenic
1124354317 15:28983952-28983974 GCCCTGCCCTGCCCTGCCCCAGG + Intronic
1124952644 15:34337866-34337888 GACCTGGCCTCCCCCAGCCCCGG + Intronic
1125045019 15:35235230-35235252 GAACTGGACTTTCCTACCCCTGG - Intronic
1125311971 15:38389659-38389681 GTCCAGATATTCCCTACCCCTGG + Intergenic
1125507380 15:40274564-40274586 GTCCTGGCTTTCCCTGCTCATGG - Intronic
1125521158 15:40348484-40348506 CTCATGGCCTCCACTACCCCAGG + Intergenic
1127872661 15:63086432-63086454 ATCATGTCCTTCTCTACCCCTGG - Intergenic
1128078517 15:64842703-64842725 GTCCCTGCCTTCCCCACCCGAGG + Intronic
1128706736 15:69842343-69842365 GACCTGGCTTTCCCTGCCACCGG - Intergenic
1129264769 15:74387687-74387709 GTGCTGGCATTCCCTCACCCTGG - Intergenic
1130088534 15:80799421-80799443 GACCAGGCCTTCCCTAGCCTGGG - Intronic
1130334965 15:82950937-82950959 TTTCTGGCCCTCCCTCCCCCTGG - Intronic
1130678407 15:85974383-85974405 GTCCCGTCCTTCCCTCCTCCAGG - Intergenic
1131682539 15:94738949-94738971 GTCCTGGACTCCCCACCCCCAGG + Intergenic
1132603490 16:784108-784130 GCCCCGGCCTCCCCTCCCCCAGG - Intergenic
1132607758 16:800622-800644 CTCCGGGCCCTCCCTAGCCCCGG + Intronic
1132726798 16:1342419-1342441 GGCCTGGGCTTCCCTTCTCCGGG - Intronic
1132821184 16:1872052-1872074 GACCTGGCCCGCCCGACCCCCGG + Exonic
1132891864 16:2208623-2208645 GCCCTGGCCTCCCCCATCCCTGG + Intronic
1132970065 16:2682829-2682851 GTCCTGGCCTTCCCGGCCTGCGG + Intronic
1132986827 16:2771695-2771717 GTCCTTCCCTTTCCTCCCCCTGG + Intronic
1133034278 16:3026343-3026365 GACCTTGCCTTTCCTTCCCCAGG + Exonic
1133692843 16:8233113-8233135 GTCTTAGCCTTCCCTCACCCAGG - Intergenic
1137499370 16:48998451-48998473 CTCCTGGGCTTCCCTCCCACTGG - Intergenic
1137942090 16:52698308-52698330 CTCCTGGACTTCCCTAACCTGGG - Intergenic
1140032108 16:71347218-71347240 ATCCTTGCCTTCCCTTCTCCAGG + Intergenic
1140250752 16:73292361-73292383 GTTCTGACATTCCCTACTCCAGG + Intergenic
1141407129 16:83804456-83804478 GACCTGGGCTGCCCTAGCCCTGG - Intergenic
1142286804 16:89174834-89174856 GTGCTTGCGTCCCCTACCCCAGG + Intronic
1142624038 17:1180883-1180905 CTCCTGTCCTTCCCTGCTCCAGG - Intronic
1142643859 17:1299862-1299884 GACCTGCTCTTCCCTTCCCCGGG - Exonic
1143107312 17:4536184-4536206 GCCCTGGCCAGCCCCACCCCGGG - Intronic
1143323460 17:6082787-6082809 CTCGTGGCCCTCCCTAACCCAGG - Intronic
1143490847 17:7284463-7284485 GGCCTGACCTTCCCTTCTCCAGG + Exonic
1143564549 17:7713716-7713738 GTCCTGTTCTTCCCTAGCCTCGG + Intergenic
1147190659 17:38736170-38736192 GTCCTCCGCTTCCCTCCCCCAGG - Exonic
1147343821 17:39773192-39773214 GTCCAGGCCCTTCCTTCCCCAGG - Intronic
1148081525 17:44969669-44969691 TCCCTGGCCTTCCCTACCCAAGG + Intergenic
1148565687 17:48631679-48631701 GTCTTGCCCTGCCCAACCCCTGG + Intronic
1149242185 17:54663390-54663412 ATTCTGCCCTTCCCCACCCCAGG + Intergenic
1149868173 17:60161997-60162019 GTCCTGGCCTTTCCAACCTAAGG + Intronic
1150694849 17:67395883-67395905 GTCATGGCCTTCAATAGCCCAGG - Intronic
1150818748 17:68417563-68417585 GTTCAGGGCTTCCCTACTCCTGG + Intronic
1151517328 17:74604967-74604989 GCCCTGCCCTTCCCTAGCCTTGG - Intergenic
1152101066 17:78301989-78302011 GGCCTGGCCTGCCCTGCACCGGG + Intergenic
1152552326 17:81035729-81035751 GTCCTGGCCGCCGCAACCCCTGG - Intronic
1152586836 17:81193008-81193030 CTCGTGGCCTTGCCTGCCCCCGG - Intronic
1152869485 17:82744411-82744433 CTCGTGCCCTTCCCTGCCCCTGG + Intronic
1152898763 17:82928283-82928305 CTCCTGCCCGGCCCTACCCCGGG - Intronic
1153161199 18:2206493-2206515 GTCCTCCCCTTCCCCACTCCAGG + Intergenic
1154335002 18:13457889-13457911 TTCCTGTCCTTCACTGCCCCAGG + Intronic
1155213318 18:23620891-23620913 GGCCTTGCCTTCCCGACACCAGG - Intronic
1157169176 18:45386304-45386326 GGCCTGGCCTTCCCTATCTATGG - Intronic
1157617723 18:48997066-48997088 GCCCTGGCCTGCCCTCCCCAGGG - Intergenic
1160033181 18:75279616-75279638 GTCCTGGGCTGCTCTGCCCCAGG - Intronic
1161315335 19:3614843-3614865 GTCCTGGCCTCCCCCACGCTGGG - Intronic
1161801238 19:6417711-6417733 GGCCTGGCCCACCCTGCCCCTGG - Intronic
1162303003 19:9854805-9854827 GTCCTGGAGTTCCGTACCCTGGG - Exonic
1163312091 19:16520837-16520859 CTCCTGGCCTTTCCTCCGCCGGG + Exonic
1163364111 19:16866596-16866618 GTCCTGGCTCTCCCGACCGCCGG + Intronic
1163698001 19:18773705-18773727 GTGCTGGCCTTCCCTTCCTTGGG + Intronic
1164463028 19:28464577-28464599 GCCCTGGCCCTCCCCATCCCAGG - Intergenic
1164463244 19:28465956-28465978 TTCCTTGCCTTCCCTACCCCTGG - Intergenic
1164553521 19:29232448-29232470 TCCCTGTCCCTCCCTACCCCAGG - Intergenic
1164868223 19:31622851-31622873 GTGATGGCCTTCCCTTCACCAGG - Intergenic
1165737355 19:38185141-38185163 CTCCTGGCCTTCAGTAGCCCAGG + Intronic
1165832460 19:38736413-38736435 GTCCACGCCTCCCCTGCCCCCGG + Intronic
1166676585 19:44745143-44745165 TTCCTGGCCTTTCCTCCCCCAGG + Intergenic
1167357048 19:49010631-49010653 GCCCTGCCCTGCCCTGCCCCAGG + Intronic
1167569318 19:50276934-50276956 GTCCTGCCCTGCCCTCCCCGTGG - Intronic
1167722371 19:51187299-51187321 TTCCTGGCCTGCCCTCCCTCAGG - Intergenic
925215295 2:2089375-2089397 CTCCAGCCATTCCCTACCCCAGG - Intronic
926161733 2:10494540-10494562 GTCCTGGCCCGCCCCAGCCCTGG - Intergenic
926444796 2:12928983-12929005 GTCCTGTTCTTCCATCCCCCAGG - Intergenic
927683831 2:25157449-25157471 GTCCTGCCCTTCCAAGCCCCTGG + Exonic
927740929 2:25569074-25569096 ATCCCGGCCTTCCCCATCCCAGG + Intronic
929322811 2:40565869-40565891 GTTCATGCCCTCCCTACCCCTGG + Intronic
930031654 2:47061623-47061645 GTCCTGGCCTTACCTCTACCTGG + Intronic
930823794 2:55675336-55675358 GTCCTGGCCTCCCATAGCACTGG - Intronic
931597915 2:63970329-63970351 GTCCTGCCCTTCCCTCAACCTGG - Intronic
931705615 2:64944122-64944144 GTTCAGGCTTTCCCCACCCCTGG + Intergenic
932013447 2:68000704-68000726 GTGCTGTCCTTCCCTTGCCCAGG - Intergenic
932126120 2:69146862-69146884 GTCCTGGCCACCCTTTCCCCTGG + Intronic
932268743 2:70390506-70390528 GACCTGGCTTACCCCACCCCAGG + Intergenic
932615412 2:73228274-73228296 CCACTGGCCTTCCCTTCCCCAGG - Exonic
937035163 2:118774948-118774970 GTGCTGGCGTCCCCCACCCCCGG + Intergenic
937278921 2:120704115-120704137 ATCCTGCCCTGCCCCACCCCCGG + Intergenic
937973722 2:127568392-127568414 CTCCTGCCCTTTCCTCCCCCAGG + Intronic
939222552 2:139320922-139320944 GGCCTCGCCCTCCCTACCTCAGG + Intergenic
939350604 2:141033092-141033114 GTCCTGTACATGCCTACCCCTGG - Intronic
940965261 2:159830278-159830300 TTCTTTTCCTTCCCTACCCCTGG + Intronic
943204016 2:184867601-184867623 GTCCTTGCCTTTCTTTCCCCTGG + Intronic
945568944 2:211439864-211439886 GTCTTCCCCTTCTCTACCCCTGG - Intronic
946565171 2:220956570-220956592 GCCCTTGCCTTCCCTTCCCTTGG + Intergenic
947935343 2:233999142-233999164 GCCCTGCCCTGCCCTGCCCCAGG - Intronic
948064636 2:235067949-235067971 TTCCTGGCATTCCTTACCCTGGG + Intergenic
948663161 2:239519089-239519111 GTCCTGTGCTTCCCCAGCCCCGG + Intergenic
1168933570 20:1644574-1644596 ATCCTGGCCACCCCTTCCCCTGG + Intronic
1169266899 20:4172443-4172465 GTCCTCCCCCACCCTACCCCAGG - Intronic
1171265341 20:23767109-23767131 TTCCTGGCCTTCCTCACCCCAGG - Intergenic
1171436534 20:25129426-25129448 TTCCTGGCCTTCCCTTTCCCAGG + Intergenic
1171963837 20:31514887-31514909 GGGCTGGCATTTCCTACCCCGGG + Intronic
1172097265 20:32466559-32466581 CTCCTGGCCTCCCCTCCCCCAGG - Intronic
1172248952 20:33465561-33465583 GCCCTGGCCTGTCCCACCCCGGG - Intergenic
1172756669 20:37289960-37289982 GTCCGGGCCTTTCCTCCCACGGG + Intronic
1173050958 20:39561384-39561406 GTTCTGGCCTTCCCTCCCTGTGG - Intergenic
1174111171 20:48198873-48198895 GTCCTGGCATTCCCTACTCTGGG + Intergenic
1174424118 20:50420048-50420070 GTCCTGACCATCCCGGCCCCGGG + Intergenic
1174553635 20:51378834-51378856 GACCTGGCCTGGCCTACCCCTGG - Intergenic
1175176494 20:57115460-57115482 ATCCTGGACTTCCCAACCTCCGG - Intergenic
1175365087 20:58447997-58448019 CTCGTGGCTTTCCCTGCCCCCGG + Exonic
1175932534 20:62499385-62499407 TTCCTGCCCTGCCCTTCCCCAGG - Intergenic
1178966264 21:37121403-37121425 GTCATCGCCTTTCCTACACCTGG - Intronic
1179799649 21:43804919-43804941 GCCCTGGCCTTCCCTCTCCTTGG - Exonic
1179902332 21:44400625-44400647 TTCCTGGCCTCCCCAACCCCAGG - Intronic
1179909625 21:44441036-44441058 GTCCCCGCCTTCCCTCTCCCCGG - Intronic
1180010368 21:45045988-45046010 GTCTTGGACTTCCCAACCTCTGG - Intergenic
1180625400 22:17190670-17190692 TTCCTGGCCTGCCCCACCCATGG + Intronic
1181581251 22:23829290-23829312 GCCCTGGCCATCCTCACCCCAGG - Intronic
1181625875 22:24121774-24121796 GTCCTGTCCTCCCCCACCTCTGG + Intronic
1181802102 22:25354466-25354488 TTCCTGTCCTGCCCTTCCCCAGG + Intronic
1182288150 22:29260054-29260076 GTCCTGGGCCTCCCTAGCCCAGG - Exonic
1183293530 22:37017293-37017315 CACCTGGCCTTCCCTTCCACAGG + Intronic
1183541388 22:38431246-38431268 TTCCTGGACTTCCCCACCTCTGG + Intronic
1184136670 22:42553900-42553922 GTCCTGCCCCGCCCTACCCCAGG - Exonic
1184640153 22:45866437-45866459 GTCCCTGCCGTCCCTTCCCCGGG + Intergenic
1185080162 22:48705239-48705261 GTCCTGCCCCACCCCACCCCCGG - Intronic
1185372015 22:50465361-50465383 GTCCTGCCAATCCCCACCCCAGG + Intronic
949706338 3:6822062-6822084 ATCCTGGACTTCCCTTTCCCTGG + Intronic
950041320 3:9920991-9921013 ACCCTGCCCCTCCCTACCCCCGG - Intronic
950199984 3:11035917-11035939 GTCTTGGCCCTTCCTACCGCTGG - Intronic
950427391 3:12931792-12931814 GACCTGGCCTCCCCTACACTCGG - Intronic
950449153 3:13055862-13055884 TGCCTGGCCTGCCCCACCCCGGG - Intronic
951943901 3:28112634-28112656 GTCCTGGCAATCCCTACAGCTGG + Intergenic
952890505 3:38037217-38037239 GTCCTGTCCTTCCCTATAACAGG + Intergenic
953031656 3:39183859-39183881 TTCCTGGCCTCCACTGCCCCAGG - Exonic
953823921 3:46233690-46233712 GTCCTGGCTTTTCCTACCACGGG - Intronic
955418973 3:58718436-58718458 CTCCAGGCCTCCCCTTCCCCTGG + Intronic
956097874 3:65736564-65736586 GTGCTGCCCTTACCCACCCCAGG - Intronic
960092973 3:113660531-113660553 ATGGTGGCCTTCCCTACTCCAGG + Exonic
961447382 3:126987299-126987321 GTCCTGGCCTCCACTGCCTCTGG - Intergenic
963994995 3:151698162-151698184 GTCTTGGCCTTTCCTATCACTGG + Intergenic
964791798 3:160460146-160460168 GCCCTGGCCTTCGCTAGCACAGG - Intronic
967884794 3:194325950-194325972 GTCCGGCCCTTCCCCAGCCCCGG + Intergenic
968558366 4:1261859-1261881 GTCCTCACGTTCCCCACCCCGGG - Intergenic
968704814 4:2072908-2072930 GTGCTGGCCTCCCCTCACCCTGG + Intronic
968831110 4:2933457-2933479 GTCCTTGCCTTCCCACTCCCTGG - Intronic
968975876 4:3821801-3821823 GCCCTGCCTTTCCCTGCCCCAGG - Intergenic
969239599 4:5889779-5889801 GCCCTGACCTTCACCACCCCAGG + Intronic
969418204 4:7074756-7074778 GTCCTGGCCTTCCCTGGCCCTGG - Intergenic
971296381 4:25397085-25397107 GTCCTGGTCATCCTTACCTCAGG + Intronic
974073722 4:57149311-57149333 CTGCTGGCCTGACCTACCCCAGG - Intergenic
980744683 4:136999375-136999397 GTGCTGCCCTTCCCCAGCCCAGG + Intergenic
981032642 4:140140854-140140876 CTCCTGGCCTCACATACCCCTGG - Intronic
982129246 4:152212498-152212520 CTCCTGGCCTTGACTACCCCTGG - Intergenic
982455264 4:155602343-155602365 GTCCTGGCCCACCATACCTCTGG + Intergenic
983031775 4:162811540-162811562 GGCCAGGGCTTCCCAACCCCTGG - Intergenic
985860606 5:2467799-2467821 GTCATGGGTTTCCCTACCCTTGG + Intergenic
986438876 5:7760904-7760926 TTCCTGGCCTCCCCAACACCTGG + Intronic
987292254 5:16520116-16520138 CTCCTGGCCTTCTCTCCCACCGG - Intronic
988279039 5:29121287-29121309 TTCCTGCCCCTCCCCACCCCTGG - Intergenic
997059101 5:130479259-130479281 GCCATGGCCTGCCCTACCCAAGG - Intergenic
999400490 5:151260175-151260197 GTCCTGGCCTTCTCTGGGCCTGG + Intronic
1002334273 5:178467297-178467319 GTCTTGCCCTTCCCTGCCCCTGG + Intronic
1002613596 5:180436861-180436883 GCCCTGGCCTTCCAGAGCCCAGG + Intergenic
1003396711 6:5759625-5759647 GTCCTGGCGTTTCCTAGCCAGGG + Intronic
1005812976 6:29530450-29530472 GACCTGGCCTTTCCAACCTCGGG - Intergenic
1006070571 6:31495154-31495176 TTCTTGGCCTCCCCTAGCCCAGG + Intronic
1006581743 6:35081403-35081425 GTCCTGTACTTCCCTCCCTCAGG + Intronic
1007705104 6:43785696-43785718 GTCCTTCCCTTCCCTTCCCGAGG + Exonic
1007957712 6:45932552-45932574 GCTCTGGTCCTCCCTACCCCGGG - Intronic
1008535300 6:52502754-52502776 GTCCTGTCCTTCGGTCCCCCAGG - Exonic
1010592535 6:77727147-77727169 GTTCTGACCTTCACTAACCCTGG - Intronic
1011745205 6:90402045-90402067 CTCTTTGCCTTCCCTACCCATGG + Intergenic
1012625913 6:101402859-101402881 GTCCCGGCCTTGCCCGCCCCAGG + Intronic
1013632309 6:111997448-111997470 GTCCTGGGCTTCTCTACCAGGGG - Intergenic
1014479711 6:121920854-121920876 CACATGGCCTTTCCTACCCCAGG + Intergenic
1023407899 7:39855293-39855315 TTCCTGCCCTTCCATACCCCAGG + Intergenic
1023814819 7:43941549-43941571 GTCCTCTCCTGCCCAACCCCTGG - Intronic
1025928958 7:65980092-65980114 GTCCTGCCCTGCCCTGCCCTGGG - Intronic
1026879606 7:73900355-73900377 GCCCTGGTCCTCCCTTCCCCGGG + Intergenic
1028070471 7:86443910-86443932 TTCCTCCCCTTCCATACCCCTGG - Intergenic
1029114385 7:98229829-98229851 GTCCTGGGCTTCATTACCCGTGG - Intronic
1034421116 7:150991432-150991454 GTCCTGTGCTTCCCTGCCCCTGG - Intronic
1034897187 7:154885110-154885132 CTCCTGCCCTTCCCTGCCCTTGG - Intronic
1035034419 7:155885741-155885763 CTCCTGCCCTTCCCTTCCCAGGG + Intergenic
1035153197 7:156892600-156892622 GTGCTGCCCTTCCCTTCCCGCGG - Intronic
1035171132 7:157018030-157018052 GGCCTGACCTTCCCTCCCCTGGG - Intergenic
1035264061 7:157679988-157680010 CTCCTGACCTTCCTTTCCCCAGG + Intronic
1035394690 7:158527273-158527295 GTCCTGGGCCTCCCTGACCCCGG + Intronic
1035608875 8:947673-947695 GTCCTGGCCCTCCCTGCCCACGG + Intergenic
1035981613 8:4378904-4378926 GTCTTGGACTTCCCAGCCCCTGG + Intronic
1037812326 8:22094523-22094545 GGCCTGGCCCTCCCCAGCCCAGG + Intronic
1038452978 8:27651632-27651654 GTCCGGGGCTTTCCCACCCCGGG + Intronic
1039952797 8:42185023-42185045 CTCCTGGACTTTCCTCCCCCAGG + Intronic
1045799040 8:106080256-106080278 GGCCTGGCCTTCTCTACTCCTGG + Intergenic
1046970970 8:120223077-120223099 GTCCTTGCCTTTCCCACCTCAGG - Intronic
1047766311 8:127992784-127992806 CTTCTGGCCTTGCCTTCCCCTGG + Intergenic
1048035402 8:130673019-130673041 GACCTAGGCTTCCCGACCCCTGG + Intergenic
1049433262 8:142574962-142574984 GTCTTGGCCGTCCCTACCCTGGG - Intergenic
1049752779 8:144293290-144293312 GTGTTGGCCTTCCCATCCCCAGG + Intronic
1053147319 9:35720380-35720402 GGCCTTGCCTTCTCTACCCCTGG + Intronic
1053283918 9:36838551-36838573 GTCCTGGCCTTCCCCAAGCTGGG + Exonic
1053428595 9:38027189-38027211 GCCCTGCCCTGCCCTGCCCCTGG - Intronic
1055022586 9:71686094-71686116 GTGCAGGGCTTCCCAACCCCTGG + Intronic
1056834323 9:89942434-89942456 GTCCTGGGGTTCCCTCCCCATGG + Intergenic
1056914220 9:90730654-90730676 GTCCTTTTCTTCCCTCCCCCAGG + Intergenic
1060415165 9:123424918-123424940 GTCCTTGCCATCCCTTCCTCTGG + Intronic
1060779851 9:126403374-126403396 GCCCTGGCCAGCCCCACCCCAGG + Intronic
1061078276 9:128355031-128355053 GACCCTGCCTTCCCCACCCCAGG + Exonic
1061395248 9:130340207-130340229 GCCCCGTCCTTCCCTCCCCCTGG - Intronic
1061438112 9:130579538-130579560 GTCCCGGCTTTCCCTTCCGCCGG + Intronic
1061506228 9:131033408-131033430 CTCCTGTCCTCCCCGACCCCAGG - Intronic
1062031956 9:134365776-134365798 GGGCTGGCCCTCCCTTCCCCTGG - Intronic
1062109389 9:134773683-134773705 GTCCTGGCCTACCACACCCTTGG - Intronic
1062343153 9:136102613-136102635 GTCCCGATCTTCCCTATCCCAGG - Intergenic
1062525267 9:136975721-136975743 GTCCTGGGTCTCCCTGCCCCGGG + Intergenic
1185808949 X:3087356-3087378 TTCCTGCCCTTCCCCACTCCTGG + Intronic
1188884314 X:35531306-35531328 ATGCTGCCCTTCCCTAGCCCAGG - Intergenic
1189333664 X:40157283-40157305 GTCCTGACCTTCCCCACAGCGGG - Intronic
1190878202 X:54474656-54474678 GTCTTGCCCTGCCCTCCCCCTGG + Intronic
1191292631 X:58820512-58820534 GTTCTTTCCTTCCCTACCACAGG - Intergenic
1191309546 X:59046034-59046056 GTTCTTTCCTTCACTACCCCAGG - Intergenic
1191353723 X:59636967-59636989 GTTCTTTCCTTCACTACCCCAGG - Intergenic
1191356033 X:59667832-59667854 GTTCTTTCCTTCACTACCCCAGG - Intergenic
1191379949 X:59987382-59987404 GTTCTTTCCTTCACTACCCCAGG - Intergenic
1191388928 X:60107203-60107225 GTTCTTTCCTTCACTACCCCAGG - Intergenic
1191423821 X:60574684-60574706 GTTCTTTCCTTCACTACCCCAGG - Intergenic
1191452250 X:60955425-60955447 GTTCTGTCCTTCACTACCACAGG - Intergenic
1191452630 X:60960390-60960412 GTTCTTTCCTTCACTACCCCAGG - Intergenic
1191468808 X:61177071-61177093 GTTCTGTCCTTCACTACCACAGG - Intergenic
1191471393 X:61211688-61211710 GTTCTTTCCTTCCCTACCACAGG - Intergenic
1191479837 X:61324668-61324690 GTTCTTTCCTTCCCTACCACAGG - Intergenic
1191487117 X:61422569-61422591 GTTCTGTCCTTCACTACCACAGG - Intergenic
1191488513 X:61441088-61441110 GTTCTTTCCTTCCCTACCACAGG - Intergenic
1191489870 X:61459264-61459286 GTTCTTTCCTTCCCTACCACAGG - Intergenic
1191494302 X:61518421-61518443 GTTCTTTCCTTCCCTACCACAGG - Intergenic
1191518920 X:61847695-61847717 GTTCTTTCCTTCACTACCCCAGG - Intergenic
1191527477 X:61962219-61962241 GTTCTGTCCTTCACTACCACAGG - Intergenic
1191531556 X:62016570-62016592 GTTCTTTCCTTCACTACCCCAGG - Intergenic
1191533997 X:62049146-62049168 GTTCTTTCCTTCCCTACCACAGG - Intergenic
1191548608 X:62244842-62244864 GTTCTTTCCTTCACTACCCCAGG - Intergenic
1191550300 X:62267469-62267491 GTTCTTTCCTTCCCTACCACAGG - Intergenic
1192170436 X:68851408-68851430 ATCCTTGCATTCCCCACCCCAGG + Intergenic
1194445840 X:93986524-93986546 GTGCTGGCCATTCCTCCCCCTGG - Intergenic
1195852280 X:109295954-109295976 GTGCTACCCTCCCCTACCCCTGG - Intergenic
1197403942 X:126027620-126027642 GTGCTGCCCTTCCCCAACCCAGG + Intergenic
1198535148 X:137577900-137577922 CCCCTGGCCTTCCCAACACCTGG - Intergenic
1198808352 X:140510242-140510264 GTCCAGGCCTGCCCTCCCACTGG + Intergenic
1199785595 X:151102328-151102350 GTCCTGGCATTCCTTACTCAAGG + Intergenic
1200002135 X:153067519-153067541 GTCCAGGCCCCCCCGACCCCGGG - Intergenic
1200005598 X:153082506-153082528 GTCCAGGCCCCCCCGACCCCGGG + Intergenic
1200235742 X:154466953-154466975 GCCCAGGCCTTCCCTGACCCTGG - Intronic