ID: 1069905193

View in Genome Browser
Species Human (GRCh38)
Location 10:71728087-71728109
Sequence TTGGACAAGCAGATTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069905189_1069905193 -4 Left 1069905189 10:71728068-71728090 CCCTTGGAGTCAAGGTCATTTGG 0: 1
1: 0
2: 0
3: 6
4: 107
Right 1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG No data
1069905187_1069905193 3 Left 1069905187 10:71728061-71728083 CCCACAACCCTTGGAGTCAAGGT 0: 1
1: 0
2: 0
3: 5
4: 117
Right 1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG No data
1069905183_1069905193 14 Left 1069905183 10:71728050-71728072 CCTGTTTTTTCCCCACAACCCTT 0: 1
1: 0
2: 4
3: 26
4: 321
Right 1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG No data
1069905191_1069905193 -5 Left 1069905191 10:71728069-71728091 CCTTGGAGTCAAGGTCATTTGGA 0: 1
1: 0
2: 0
3: 4
4: 135
Right 1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG No data
1069905181_1069905193 20 Left 1069905181 10:71728044-71728066 CCTGGCCCTGTTTTTTCCCCACA 0: 1
1: 0
2: 3
3: 114
4: 430
Right 1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG No data
1069905185_1069905193 4 Left 1069905185 10:71728060-71728082 CCCCACAACCCTTGGAGTCAAGG 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG No data
1069905188_1069905193 2 Left 1069905188 10:71728062-71728084 CCACAACCCTTGGAGTCAAGGTC No data
Right 1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG No data
1069905182_1069905193 15 Left 1069905182 10:71728049-71728071 CCCTGTTTTTTCCCCACAACCCT 0: 1
1: 0
2: 3
3: 30
4: 345
Right 1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069905193 Original CRISPR TTGGACAAGCAGATTGAGGA AGG Intronic
No off target data available for this crispr