ID: 1069905595

View in Genome Browser
Species Human (GRCh38)
Location 10:71730449-71730471
Sequence CACCTGTGGGAGCCGGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069905595_1069905600 -10 Left 1069905595 10:71730449-71730471 CCCTGGCCCGGCTCCCACAGGTG 0: 1
1: 0
2: 4
3: 30
4: 246
Right 1069905600 10:71730462-71730484 CCCACAGGTGATTGTGTACGTGG 0: 1
1: 0
2: 0
3: 12
4: 75
1069905595_1069905602 -7 Left 1069905595 10:71730449-71730471 CCCTGGCCCGGCTCCCACAGGTG 0: 1
1: 0
2: 4
3: 30
4: 246
Right 1069905602 10:71730465-71730487 ACAGGTGATTGTGTACGTGGAGG 0: 1
1: 0
2: 0
3: 12
4: 104
1069905595_1069905603 8 Left 1069905595 10:71730449-71730471 CCCTGGCCCGGCTCCCACAGGTG 0: 1
1: 0
2: 4
3: 30
4: 246
Right 1069905603 10:71730480-71730502 CGTGGAGGACATCAACGATGAGG 0: 1
1: 0
2: 0
3: 2
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069905595 Original CRISPR CACCTGTGGGAGCCGGGCCA GGG (reversed) Intronic
900184569 1:1327070-1327092 CACATATGGGACTCGGGCCAGGG - Intronic
900218674 1:1495649-1495671 CACCTCATGGAGCCTGGCCACGG + Exonic
900284578 1:1892942-1892964 CCCCTGTGGGGGCGGGGCCTCGG - Intergenic
900422494 1:2561653-2561675 CACCTGCGGGAGTGGGGCCGAGG - Exonic
901082285 1:6590303-6590325 GGGCTGTGGGAGCCGGGCCCGGG + Intergenic
901628006 1:10634561-10634583 CACCCGTGGGCGCCGGGCCTTGG - Intergenic
902332387 1:15736901-15736923 CCCCTGTGGGAGCTGGGTCATGG - Intronic
904063110 1:27726318-27726340 CACGTGCGGGAGCCGGGACCCGG + Intronic
904314620 1:29652181-29652203 CTCCTGTGAGCGCAGGGCCAGGG + Intergenic
904592965 1:31625476-31625498 GACCTGTGGGAGGAGGGCCCTGG + Intronic
906205861 1:43985964-43985986 CACCTGTGGGACCCCTGCCGGGG + Intronic
906710256 1:47924170-47924192 CACCTGTGGGAACCTGGACAGGG - Intronic
907372927 1:54014570-54014592 CAGCTGTGGGCCCCTGGCCAGGG - Intronic
907866259 1:58402245-58402267 CCACTGTGGGACCCAGGCCAAGG + Intronic
908260552 1:62336800-62336822 CACCTGGAGGAGCCGGGCCAAGG + Intergenic
913039455 1:115008457-115008479 CACCTGTGGGAGCCTGCCAAAGG + Intergenic
914754327 1:150554208-150554230 CACCTGAGGGAGAAGGGCCTTGG + Intronic
914942953 1:152038558-152038580 CACCTGTGAGAGCAGGTGCAGGG - Intronic
915246125 1:154557745-154557767 CACCTGTGGGATCCCCGCCTAGG - Intronic
915737628 1:158094847-158094869 CAGCTGGGGCAGCAGGGCCAGGG - Exonic
916053357 1:161051311-161051333 CACCTGGGGGGCCAGGGCCAAGG + Exonic
918038402 1:180897182-180897204 CAGCCGTGGGAGCTGGGCCCAGG - Intergenic
918815068 1:189171166-189171188 CACCTATGGGAGCCTGCCAAAGG - Intergenic
919124626 1:193379843-193379865 CACCTGTGGGGGCCTGCCAAAGG + Intergenic
919838221 1:201591273-201591295 CACCTGGGGGAGACGAGGCAAGG + Intergenic
922476281 1:225908896-225908918 CAGGTGTGGAAGCCAGGCCAAGG - Intronic
922783683 1:228272687-228272709 CCTCTGTGGGTGCTGGGCCATGG + Intronic
1062856332 10:781246-781268 CACCCGTGGTACCAGGGCCACGG - Intergenic
1063067485 10:2624036-2624058 CTCCTGTGGGCACCGGGGCAGGG + Intergenic
1063079776 10:2754816-2754838 CACCTGGGGGACCCAGGGCATGG + Intergenic
1065552036 10:26877707-26877729 CACCTGTGTGACCCTGGGCAAGG + Intergenic
1067019084 10:42779662-42779684 CACCTGCAGGAGCCAGGCCAGGG + Intergenic
1067333130 10:45340155-45340177 CACCTGTGGGGGCCTGCCAAAGG - Intergenic
1069268234 10:66490686-66490708 CTCATGTGGTAGCAGGGCCATGG + Intronic
1069905595 10:71730449-71730471 CACCTGTGGGAGCCGGGCCAGGG - Intronic
1069920145 10:71811491-71811513 CATCTGCGGGAGCAGGACCAGGG - Exonic
1070720322 10:78752469-78752491 GACCAGGAGGAGCCGGGCCAGGG + Intergenic
1073218558 10:101850901-101850923 CAACTGTGACAGCCTGGCCAGGG - Intronic
1073918486 10:108432377-108432399 CACCTATGGGAGCCTGCCAATGG + Intergenic
1075340761 10:121645343-121645365 CACCTGTGGCTACCTGGCCATGG - Intergenic
1075398083 10:122142238-122142260 CAAGTGTGGGAGCAGAGCCAGGG - Intronic
1075631589 10:124003896-124003918 GACCTGGGGGAGATGGGCCAGGG + Intergenic
1075689830 10:124387389-124387411 CACCTGTCAGAGCAGGGCCGGGG + Intergenic
1075930765 10:126293409-126293431 TACCTGTAGGGGCCAGGCCAGGG - Intronic
1076540457 10:131211194-131211216 CACTTGTGGGACCAGAGCCACGG - Intronic
1076855868 10:133115401-133115423 CACCTGTGAAAGCCGGGCCCTGG + Intronic
1076927427 10:133499288-133499310 CACCTATGGGAGCCTGCCAAAGG + Intergenic
1077094988 11:795470-795492 CACCTCTGGGGGCAGTGCCAGGG + Intronic
1077137446 11:1008144-1008166 CGCCTGTGCGCCCCGGGCCAAGG + Intronic
1077171028 11:1165803-1165825 AGCCTGTGGGAGGCTGGCCATGG - Intronic
1077538878 11:3137334-3137356 CAGCTGTGGCAGCTGGGCCCTGG + Intronic
1077674970 11:4187485-4187507 CAGCTGCGGCAGCCGGGCCATGG - Intergenic
1077675392 11:4190092-4190114 CAGAGGTGGGAGCAGGGCCATGG + Intergenic
1079003561 11:16777079-16777101 CAACTGTGGAAGCCTAGCCAGGG + Intergenic
1082784582 11:57309875-57309897 CACCTATGGCAGCCGGGCTGCGG - Exonic
1082784916 11:57311484-57311506 CTCCGGAGGGAGCAGGGCCAGGG - Intronic
1084816647 11:71651325-71651347 CACGTGTGTGAGCACGGCCATGG + Intergenic
1089051908 11:115552963-115552985 CACCAGTGGGTCCAGGGCCAAGG + Intergenic
1089662379 11:119993930-119993952 CCCCTGTGGGGGCAGGGACAAGG + Intergenic
1089903598 11:122013520-122013542 CACCTATGGGAGCCCGTCAAAGG - Intergenic
1090204015 11:124875091-124875113 CACCTGTGGGAGACAGGACAAGG - Exonic
1090395212 11:126414254-126414276 GAGCCGTGGGAGCCCGGCCAGGG + Exonic
1090401512 11:126452490-126452512 CAGCTGTGGGTGCCGGGCTGGGG + Intronic
1091288891 11:134425832-134425854 CACCTGTTGCAGCCTGGCCACGG - Intergenic
1091831697 12:3554723-3554745 CTCCTGAGGGAGCCTGGGCAGGG + Intronic
1092503264 12:9068287-9068309 CATCTGTGGGATACAGGCCAAGG + Intronic
1093308657 12:17550671-17550693 CAACTGTGGGAGCAGGCTCAAGG - Intergenic
1095603841 12:44044246-44044268 CACCTGTGGGGGCCTGCCAAAGG - Intronic
1095856252 12:46863762-46863784 CACCTATGGGAGCCTGCCAAAGG + Intergenic
1096542349 12:52314816-52314838 CACCTGTGGGAACAAGGGCAGGG + Exonic
1098831916 12:75374112-75374134 CACCTATGGGAGCCCGCCAAAGG + Intronic
1099183392 12:79492675-79492697 CACCTATGGGAGCCTGCCAAAGG + Intergenic
1101534678 12:105606191-105606213 CACCTATGGGAGCCTGCCCAAGG + Intergenic
1102240613 12:111322401-111322423 CACCTGCGAGGGGCGGGCCAGGG - Exonic
1102583040 12:113903914-113903936 GACCTCTGGGATCCGGACCATGG + Intronic
1103369614 12:120408836-120408858 GTCCTGTGGGAGCCTGGACAGGG + Intergenic
1103443228 12:120978750-120978772 GCCCTGTGGCAGCCGAGCCATGG + Exonic
1104462973 12:128970147-128970169 CACTGGTAGAAGCCGGGCCAGGG + Intronic
1104902540 12:132197226-132197248 CCCCATTGTGAGCCGGGCCACGG - Exonic
1104937693 12:132375310-132375332 CACCTGAGGGGGCCGAGCCGCGG + Intergenic
1107410285 13:40151926-40151948 CACCTAGGGAAGCCAGGCCAGGG + Intergenic
1108493644 13:51004461-51004483 CACCTGTGGGAAACCTGCCAGGG - Intergenic
1109951035 13:69502292-69502314 CACCTATGGGAGCCTGCCAAAGG + Intergenic
1112771400 13:102798853-102798875 CACCTGGGCGCGCCGGGGCACGG - Exonic
1113349381 13:109513577-109513599 CACCTGTGGGCTCAGGGCCTGGG + Intergenic
1113613120 13:111661941-111661963 CACCTGTGGGAGGCAGGAGACGG - Intronic
1113784837 13:112996989-112997011 CAGCTGTGGGAGCTGGGCCTAGG + Intronic
1113848606 13:113405610-113405632 CGCCTCTGGGTGCCGGGCGAGGG + Intergenic
1114758270 14:25283965-25283987 CACCTATGGGAGCCTGCCAAAGG + Intergenic
1115059704 14:29173807-29173829 CACCTATGGGAGCCTGCCAAAGG - Intergenic
1117216830 14:53560088-53560110 CACCTATGGGAGCCTGACAAAGG - Intergenic
1117634120 14:57724286-57724308 CACCTATGGGAGCCTGCCAAAGG - Intronic
1119766830 14:77195761-77195783 CAGCTGTGGGGAGCGGGCCATGG - Intronic
1119861186 14:77937357-77937379 CAGCTGTGGCAGCAGGGCCCTGG - Intergenic
1121321650 14:92995065-92995087 CACCACTGGGAGCCGGGAGAGGG + Intronic
1122599500 14:102914357-102914379 CACCTGTGGCTGCAGGGTCAAGG - Intergenic
1122828957 14:104386405-104386427 CGCCTGGTGGAGCCGGGCCTGGG + Intergenic
1124093844 15:26630138-26630160 CACCTCCGGGAGCCTGGCCGAGG - Intronic
1124600937 15:31132288-31132310 GGCCTGTGGGAAACGGGCCATGG - Intronic
1124620787 15:31272755-31272777 CACCTGTGGGGGCAGGGCCACGG - Intergenic
1124880657 15:33639639-33639661 CCCCAGTGGGAGCTGGGCCATGG + Intronic
1129262864 15:74378541-74378563 CACCTGGGGGAACCGGGTGAAGG - Intergenic
1129410435 15:75347867-75347889 GCCCTGTGGGTGCCAGGCCAGGG + Intronic
1131801685 15:96075666-96075688 CAACTGTGGTAGCTGGGTCATGG - Intergenic
1132522193 16:397075-397097 CCCCCGTGAGCGCCGGGCCACGG + Intronic
1132591995 16:730129-730151 CACCTGTGGGCCTCGGCCCAGGG + Exonic
1132724745 16:1333840-1333862 CTCCTGGGGGACCCGGACCAAGG - Intronic
1132997299 16:2829959-2829981 CACCTGAGGGTGGCGGGTCAAGG - Intergenic
1134207566 16:12250377-12250399 CACAGGTGGGAGCCGGGCAGAGG + Intronic
1134441824 16:14303025-14303047 CGCCTGCGGGGGCCGGGCCCCGG + Intergenic
1136613415 16:31380780-31380802 CACCTCTTGGAGCAGGGCCTGGG + Intronic
1141280997 16:82629211-82629233 CACCTGTGCCAGCCTGGCCCTGG - Intronic
1141560332 16:84863568-84863590 CAGCTGTGCGAGCCTGGGCAGGG + Intronic
1141686076 16:85570747-85570769 CACCTGTTGGTGCCAGGCCCTGG + Intergenic
1141710347 16:85695321-85695343 CACCTCTAGGGGCAGGGCCAGGG + Intronic
1141953240 16:87352933-87352955 CACCTGTGGCACGTGGGCCAAGG - Intronic
1142620065 17:1159897-1159919 GACCTGTGGGAGCCCCTCCAGGG + Intronic
1142966290 17:3583797-3583819 CACTCGTGGGAGACTGGCCATGG - Intronic
1143499465 17:7330367-7330389 CAGCGGTGGGGGCGGGGCCAGGG + Intergenic
1144445388 17:15322623-15322645 AACCTGTGGGAGCAGGGTCTGGG - Intronic
1144454062 17:15404601-15404623 CACCTGGGGGAGCTGGGGCCAGG + Intergenic
1144711930 17:17406905-17406927 GACCTGTGTGATCCGGTCCATGG + Intergenic
1146850923 17:36220953-36220975 CACCTATGGGAGCCTGCCAAAGG - Intronic
1147905227 17:43818194-43818216 CACCTGTGGGATCCAGGCCTTGG - Intronic
1148022481 17:44562585-44562607 CACCTGTGGCACCTGGGCCTGGG + Intergenic
1148341407 17:46875611-46875633 CACCAGTGGGAGCCAGGCTTAGG + Intronic
1148733429 17:49851377-49851399 CCCCCGCGGGAGCCGGGCCGGGG + Intergenic
1152121892 17:78423909-78423931 AACCTGTAGGAGCAGCGCCACGG + Exonic
1156454297 18:37284394-37284416 GACCTCTGGGAGCCTGGCCTGGG + Intronic
1156990317 18:43400866-43400888 CACCTATGGGAGCCTGCCAAAGG + Intergenic
1160092450 18:75839924-75839946 CACCTGTGGGGGCCTGCCAAAGG - Intergenic
1160785781 19:899722-899744 GACCTGTGGGTGGGGGGCCAGGG + Intronic
1161771865 19:6235314-6235336 CACCAGCAGGAGCCTGGCCACGG + Intronic
1162110036 19:8395091-8395113 CAGCTACGGGAGCCTGGCCAAGG - Intronic
1162536780 19:11267277-11267299 CCCCTGTGGAAGCTGGGTCAAGG + Intergenic
1163439009 19:17312231-17312253 GCCCTGTGTGAGCCCGGCCAGGG + Intronic
1165139577 19:33690645-33690667 CACCTGTGGGGGCCCGGCACAGG - Intronic
1165152978 19:33771783-33771805 GGCCTTTGGGTGCCGGGCCAGGG + Intronic
1165383589 19:35497433-35497455 GAGGTGTGGCAGCCGGGCCAGGG + Exonic
1166283522 19:41810182-41810204 CACCTGTGGGCTCTGGGTCATGG + Intronic
1166558824 19:43718801-43718823 CGCCCGTGAGAGCCGCGCCAGGG - Exonic
1168724092 19:58571186-58571208 CAGCTCTCGGAGCTGGGCCAGGG + Exonic
926121886 2:10245754-10245776 CACAGGTGGGAGCCTGGCCTTGG + Intergenic
926316537 2:11714492-11714514 CACCTCTGGGAGTGGGGCGAGGG - Intronic
927096422 2:19750828-19750850 CACCTGTGGCAGCTGAGCCCTGG + Intergenic
929033697 2:37671783-37671805 CACCGGTTGGCCCCGGGCCAGGG - Exonic
933892418 2:86783983-86784005 CTCCTGTGGAAGCAGGGCCTGGG - Intergenic
935564322 2:104590342-104590364 CACCTATGGGAGCCTGCCAAAGG + Intergenic
936164171 2:110105505-110105527 GCCCTGTGGGAGCCAGACCAAGG + Intronic
939629827 2:144517481-144517503 CGCCCAGGGGAGCCGGGCCAGGG + Intronic
940171326 2:150832801-150832823 CACCTATGGGAGCCTGCCAAAGG + Intergenic
943646128 2:190408850-190408872 CAGCTGTGGGCGCCCGGCGAGGG - Intronic
946009192 2:216551396-216551418 CACGTCTGGGAGCCTGGCCAAGG - Intronic
947529903 2:230902261-230902283 CACCTGAGGGAGGAGAGCCAGGG + Intergenic
948585199 2:239014962-239014984 CACCTGTGGCAGTGTGGCCAGGG + Intergenic
948597714 2:239091236-239091258 CTCCTATGGGAGTCTGGCCAGGG + Intronic
948716221 2:239865325-239865347 GTTCTGTGGGAGCCGGGCCCGGG - Intergenic
948801436 2:240435340-240435362 CACCTGTGGGGGCGGGGACGGGG - Intergenic
1170843620 20:19943860-19943882 CAACTGTGTTAGCCAGGCCAGGG + Intronic
1171023554 20:21608458-21608480 CACCTGCGGATGCCAGGCCATGG + Intergenic
1171983628 20:31644504-31644526 GGACTGTGGGAGCTGGGCCAAGG - Intronic
1172777406 20:37415542-37415564 CCCCTGTGGGTGCTGGGTCAGGG - Intergenic
1173616413 20:44406125-44406147 CATCTGCGGGGACCGGGCCACGG + Exonic
1173869019 20:46330332-46330354 CACCCGTGGGCGCCAGCCCAGGG + Intergenic
1175371713 20:58496833-58496855 CCCCTGAGGGGGCCAGGCCAGGG + Intronic
1175837194 20:62003828-62003850 CACCTGCGGGGGCCGGATCAGGG + Exonic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176194420 20:63830862-63830884 CACCCGCGGGGGCCGGGCCGGGG + Intronic
1179423003 21:41251071-41251093 CACGTGAGTGAGCCCGGCCAAGG - Intronic
1179831590 21:44000449-44000471 CAGAGGTGGGAGCTGGGCCAGGG + Intergenic
1180001524 21:44997486-44997508 CAGCTCTGGGAGCTGGGCCCCGG + Intergenic
1180188426 21:46151568-46151590 AACCTGCGGGAGCAGGGCCGCGG - Exonic
1181063804 22:20295842-20295864 CTCATGTGGGTGCCGGGTCAAGG - Intergenic
1181107177 22:20582358-20582380 CCCCTGTGGGTCCCTGGCCAAGG + Intronic
1181366123 22:22378344-22378366 CACCTGTGGGACCAGGCCGAAGG - Intergenic
1183323767 22:37180547-37180569 CACCTGCAGGAGAAGGGCCACGG - Exonic
1183504705 22:38202559-38202581 CGCCCGCGGGCGCCGGGCCAGGG - Intronic
1183710933 22:39502684-39502706 CAACCGTGGGGGCCGGGCCGGGG - Intronic
1184344958 22:43907529-43907551 CTCCTGTGGGGGCTGGCCCAGGG + Intergenic
1184425839 22:44408899-44408921 CACATGTGGGAAGCGGGACAGGG - Intergenic
1185179361 22:49350256-49350278 CCCCTGTGGGAGCTGGGCAGGGG + Intergenic
1185330415 22:50249745-50249767 CACCTCCAGGAGCCCGGCCAGGG + Intronic
949245854 3:1924833-1924855 CACCTGTGGGAGCCTGCCAAAGG - Intergenic
949638769 3:6012426-6012448 CACCTATGGGAGCCTGCCAAAGG - Intergenic
950530417 3:13549529-13549551 GACTGGTGGGAGCCGGCCCAGGG - Intronic
951003606 3:17592762-17592784 CACCTGTGGGAGCCTGCTAAAGG - Intronic
951937077 3:28033607-28033629 CAGCTGTGAGGGCCGGGCCCTGG + Intergenic
954785079 3:53086815-53086837 CACCTTTGGGAGCTGACCCACGG - Intronic
957948800 3:87097822-87097844 CACCTCTGGGAGCAGGGCATAGG - Intergenic
959997848 3:112698233-112698255 CACCTATGGGAGCCTGCCAAAGG - Intergenic
961179411 3:124864906-124864928 CACCTGTGGAAGCCAGGGGATGG - Intronic
961457033 3:127029420-127029442 CACCTGTGGGCAGAGGGCCAGGG - Exonic
967844771 3:194034878-194034900 CAGGTGTGGGAGCAGTGCCAGGG + Intergenic
968500268 4:946727-946749 CGCCTGTGGGAGCCGGGGCTGGG - Intronic
968565650 4:1311236-1311258 TTCCTGCGGGAGCCCGGCCACGG + Intronic
969428326 4:7138698-7138720 CCACTGTGGCAGCCAGGCCAAGG - Intergenic
969531620 4:7733846-7733868 CCCCAGTGGGAGCCAGGTCAAGG + Intronic
978352163 4:107831399-107831421 CACCTGTGGAAGCTGCTCCAGGG - Intronic
979767008 4:124474505-124474527 CACCTATGGGAGCCTGCCAAAGG - Intergenic
982597785 4:157407116-157407138 CACCTATGGGAGCCTGCCAAAGG + Intergenic
983792134 4:171812603-171812625 AACCTGTGGCAGCCTCGCCAAGG - Intronic
984650044 4:182261412-182261434 CCCCTGTGGCAGCCAGGTCAGGG + Intronic
985354450 4:189102769-189102791 CATCTGTGGGAGGAGAGCCAAGG - Intergenic
986087097 5:4462628-4462650 CACCTATGGGAGCCTGCCAAAGG - Intergenic
986313863 5:6573211-6573233 CACCTGTGGCAGCAGTGCCCAGG - Intergenic
987141446 5:14951113-14951135 TACCTGTGGGAGCCAGGCCATGG + Intergenic
991685869 5:69182048-69182070 CACCTGTGCCAGCAGGGGCATGG - Intergenic
992242943 5:74789778-74789800 CACCTATGGGAGCCTGCCAAAGG - Intronic
994984433 5:106915822-106915844 CACCTGTGGGAGCCTGCCAAAGG + Intergenic
995182457 5:109241520-109241542 CACCTGGGGGAGACAGGCCATGG - Intergenic
999365427 5:151020653-151020675 CGCCTGCAGCAGCCGGGCCATGG - Exonic
1002439860 5:179258694-179258716 CCTCTGTGGGATCCGGGCCTGGG - Intronic
1002644861 5:180648159-180648181 CACCTGTGGGAGCCTGGTCCTGG + Intronic
1002939518 6:1703782-1703804 CACCAGTGGCCGCAGGGCCAAGG + Intronic
1003876661 6:10443653-10443675 TACCTTTGGGAGTTGGGCCATGG + Intergenic
1004063774 6:12223213-12223235 AACCTGTGGGAGCAGCACCAAGG + Intergenic
1006288654 6:33117250-33117272 CAGCCGTGGGGGCCGGGCCCAGG + Intergenic
1006509669 6:34515165-34515187 CAGCTGGAGGGGCCGGGCCAGGG + Intronic
1011643492 6:89435622-89435644 CACCTTCGGGATCCGTGCCAGGG - Intronic
1012820791 6:104082830-104082852 CACCTTTGGGAGCCTGCCAAAGG - Intergenic
1015095464 6:129409692-129409714 CACCTATGGGAGCCTGCCAAAGG + Intronic
1015443301 6:133272653-133272675 CACCTATGGGGGCCTGGCAAAGG + Intronic
1018919003 6:168157901-168157923 GAGCTCTGGGAGCCGGGGCAGGG - Intergenic
1019184015 6:170210333-170210355 CACCTGAGGTGGCCGGCCCAAGG + Intergenic
1019281877 7:204720-204742 CACCTGTGTGGCCCTGGCCATGG + Intronic
1019713991 7:2530034-2530056 CAGCTGTGGGGGCCCTGCCAGGG + Intergenic
1023897018 7:44442472-44442494 CACCTGGGGGACCCAGGGCAGGG + Intronic
1023982022 7:45075919-45075941 CACCAATGGGAACAGGGCCACGG + Exonic
1025253068 7:57365018-57365040 CATGTGTGGGAGCCAGGCAAGGG - Intergenic
1025983698 7:66429045-66429067 CAAGTGTGGGAACAGGGCCAAGG - Intergenic
1026031495 7:66798313-66798335 CAAGTGTGGGAACAGGGCCAAGG + Intronic
1026210949 7:68304626-68304648 CTCCTGTGGTAGGAGGGCCAGGG + Intergenic
1029665271 7:101991095-101991117 AACCTGTGGGTGCGGGGCTAGGG - Intronic
1029750700 7:102541090-102541112 CACCTGTAGGGGCCGGGTCCTGG + Intronic
1029768655 7:102640201-102640223 CACCTGTAGGGGCCGGGTCCTGG + Exonic
1030270568 7:107664520-107664542 CACGTGTGGGAGGCTGGGCATGG - Intronic
1031832985 7:126649927-126649949 CACCTGTGGGAGCCTGCCAAAGG - Intronic
1035194171 7:157201524-157201546 CACCTTTGGGAGCCGTGTCTCGG + Intronic
1035604658 8:921811-921833 CAGCCAAGGGAGCCGGGCCAGGG + Intergenic
1035747654 8:1973827-1973849 CACCTGTGGGAGCCGCGGCCCGG - Intergenic
1036121386 8:6021175-6021197 CAACTGTGGGAGTGGGGACAGGG + Intergenic
1044150791 8:88772985-88773007 CACCTATGGGAGCCTGCCAAAGG - Intergenic
1044965164 8:97567485-97567507 CACCTGTGGTAGGGGGGGCAAGG + Intergenic
1045055219 8:98362829-98362851 CAGCTGTGGGAGCAGACCCAGGG - Intergenic
1045847800 8:106658101-106658123 TACCTGAGGGAGCCAGCCCAGGG + Intronic
1049181820 8:141226804-141226826 CACCTGAGGCAGCACGGCCACGG + Intronic
1049789492 8:144466288-144466310 CAGCCGTGGGAGCCGGGCCGTGG + Exonic
1050482661 9:6102513-6102535 CACCTATGGGAGCCTGCCAAAGG - Intergenic
1051192962 9:14534226-14534248 CACCTGAGGGAGCCAGGCTGAGG - Intergenic
1053058027 9:35005730-35005752 CTCCTGGGGGAGGCGGGCCTGGG - Intergenic
1056755834 9:89381579-89381601 CACCTGTGGGTGCCCAGACAGGG - Intronic
1056793286 9:89639887-89639909 CACCTGTGAGACCCGAGCCTGGG + Intergenic
1057708129 9:97412324-97412346 CACCGGTGGGACCGCGGCCAGGG + Intronic
1057863069 9:98657474-98657496 CCCCTGTGGAACCCTGGCCAGGG + Intronic
1060538795 9:124415293-124415315 CTCGGGTGGGAGCTGGGCCAAGG - Intronic
1061384672 9:130282171-130282193 CACCCGCTGGAGCCTGGCCAAGG + Intergenic
1062016378 9:134293289-134293311 CACCTGTGTGAGCCAGGCCTTGG + Intergenic
1062403205 9:136381490-136381512 CGGCTCTGGGAGCCAGGCCAGGG + Intronic
1062426046 9:136506698-136506720 CACCGGTGGGTGCCGCGCCCAGG - Exonic
1062428718 9:136517539-136517561 CAGATGAGGGTGCCGGGCCAGGG - Intronic
1062610507 9:137371406-137371428 CTCCTGTGAGGGCCCGGCCAGGG + Intronic
1185508180 X:644176-644198 CATCCGCGGGAGCCGGGCCAGGG - Intronic
1189154896 X:38746812-38746834 CACCTATGGGAGCCTGCCAAAGG + Intergenic
1190852280 X:54257304-54257326 CACCTGGGGGAGCAGGCCTAGGG + Intronic
1191719256 X:64215800-64215822 CACCTGTGGGGGCCTGTCAAAGG + Intergenic
1191846590 X:65551661-65551683 CACCTCTGTAAGCGGGGCCAGGG - Intergenic
1192297722 X:69868107-69868129 CACCTGTGAGAGCCCGCCAAAGG + Intronic
1192538806 X:71950663-71950685 CACAAGTGGGAGCAGAGCCATGG - Intergenic
1192727611 X:73768966-73768988 GCCCTGTGGGAGCCAGGCCATGG - Intergenic
1192795187 X:74420604-74420626 CACCAGTGGGGGCCGGGCCCAGG - Intergenic
1192898692 X:75471818-75471840 CACCTGTGGGAGCCTGCCAAAGG - Intronic
1193053480 X:77125676-77125698 CACCTATGGGAGCCTGCCAAAGG - Intergenic
1193356242 X:80523033-80523055 CACCTGTGGGGGCCTGCCAATGG - Intergenic
1195470011 X:105220175-105220197 CACCTGGGGCAGCCTGGCCTTGG - Exonic
1195732659 X:107981905-107981927 CACCTGGGGCAGCCTGGCCTTGG - Exonic
1196463825 X:115953232-115953254 CACCTGTGGGACCCTGTCCTTGG + Intergenic
1197477371 X:126941421-126941443 CACCTATGGGAGCCTGCCAAAGG + Intergenic
1198534667 X:137574420-137574442 CACGTGTGAGAGCCGGGCCAGGG + Intronic
1200121667 X:153794045-153794067 CCCCTGGGGGAGCCGGTCCAGGG + Exonic
1200973135 Y:9177802-9177824 CACCTGTGGAAGCCTGGCAAGGG + Intergenic
1202137943 Y:21686711-21686733 CACCTGTGGAAGCCTGGCAAGGG - Intergenic