ID: 1069906018

View in Genome Browser
Species Human (GRCh38)
Location 10:71732657-71732679
Sequence TGTTACAGGGATATTGATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069906018_1069906024 29 Left 1069906018 10:71732657-71732679 CCGAGATCAATATCCCTGTAACA 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1069906024 10:71732709-71732731 AAGTTTATACCTATGCAGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 88
1069906018_1069906023 25 Left 1069906018 10:71732657-71732679 CCGAGATCAATATCCCTGTAACA 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1069906023 10:71732705-71732727 GATAAAGTTTATACCTATGCAGG 0: 1
1: 0
2: 1
3: 7
4: 88
1069906018_1069906021 -3 Left 1069906018 10:71732657-71732679 CCGAGATCAATATCCCTGTAACA 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1069906021 10:71732677-71732699 ACACATCCATTTTCATATGTAGG 0: 1
1: 0
2: 7
3: 73
4: 684

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069906018 Original CRISPR TGTTACAGGGATATTGATCT CGG (reversed) Intronic
908735280 1:67270094-67270116 TGGGACAGGGATACTGATCTTGG + Intergenic
910780958 1:90932604-90932626 TATAACAGTGATATTGATATGGG + Intronic
911970632 1:104430885-104430907 AGTCTCATGGATATTGATCTAGG + Intergenic
917924718 1:179779591-179779613 TGTTCCAGGGAGCATGATCTTGG + Intronic
918367962 1:183829074-183829096 AGTTACAGGGATTTGGATTTAGG + Intronic
918475094 1:184916246-184916268 TGTAACAGAGATATCGATGTAGG + Intronic
918702570 1:187623627-187623649 TGTTACAGTGATAGTGATTTGGG - Intergenic
920782725 1:209010396-209010418 TGTCACAGGGATGATGATGTTGG + Intergenic
921115004 1:212081798-212081820 TCCTGCAGGGATATTTATCTAGG - Intronic
921819583 1:219601769-219601791 GGTTACAGGAACATTGAACTAGG + Intergenic
922664037 1:227453858-227453880 TGTTTCAGGAAAATTGCTCTTGG + Intergenic
924534748 1:244925709-244925731 TTATTCAGGGATATTGATCAGGG + Intergenic
1063991413 10:11568424-11568446 GGTGAGAGGGATATTGATTTGGG - Intronic
1064347440 10:14545355-14545377 TGTTACAAAGCTATTGATCTGGG + Intronic
1068437770 10:57014730-57014752 ACTTGCAGGGATCTTGATCTTGG + Intergenic
1069813023 10:71176350-71176372 TGTTCCTGGGATTTTTATCTCGG - Intergenic
1069906018 10:71732657-71732679 TGTTACAGGGATATTGATCTCGG - Intronic
1070398875 10:76035632-76035654 TGTGACAGAGTTATTTATCTTGG + Intronic
1072049648 10:91690642-91690664 TGCTCCACTGATATTGATCTTGG - Intergenic
1074918015 10:117977046-117977068 TGTCAGAGGGAGATTGATTTAGG - Intergenic
1078344759 11:10537259-10537281 TGTTACAGGGATTTTTACCTGGG + Intronic
1080971123 11:37278589-37278611 TGTTACACTGTTTTTGATCTCGG + Intergenic
1084005943 11:66323622-66323644 GGATACATGGATGTTGATCTGGG + Intergenic
1086123851 11:83329147-83329169 TGTTCCAGGGATATACTTCTTGG - Intergenic
1086593749 11:88546202-88546224 TATTACAGTGAAATTGATTTGGG - Intronic
1087649659 11:100849871-100849893 TGTTCCAGGGAAAGTGAACTAGG + Intronic
1088345696 11:108822414-108822436 TGTTCCAGGGATGTTCTTCTTGG + Intronic
1089951568 11:122532909-122532931 TTTTACAGGTATATAGATCGAGG - Intergenic
1090433533 11:126666831-126666853 TGGTACAGGTATATTCATTTTGG + Intronic
1090877469 11:130803793-130803815 TGTTACAGGGTTTTAGAACTTGG + Intergenic
1093897476 12:24590941-24590963 TGTTACAAGGAAATAGATATTGG - Intergenic
1094008713 12:25783994-25784016 TGTAACAAGGAGATCGATCTGGG - Intergenic
1094532253 12:31287728-31287750 TGTAACAAGGAGATTGAGCTGGG + Exonic
1095808618 12:46348226-46348248 TTTTACATCGATATTCATCTGGG + Intergenic
1099081282 12:78185202-78185224 AATTACATGGATATTGAGCTTGG + Intronic
1099778081 12:87160122-87160144 TTTTAGATGGAAATTGATCTAGG - Intergenic
1101276091 12:103203092-103203114 TGATACAGGGATATTGGGCCAGG + Intergenic
1101556207 12:105812235-105812257 TGCTACAGGGAAATAGATATGGG + Intergenic
1103000695 12:117383430-117383452 TGTTTCTGGGAAATTGATCTTGG + Intronic
1113084188 13:106550665-106550687 TGTTCCAGTGATACTGATTTTGG - Intronic
1113336057 13:109377058-109377080 CTAGACAGGGATATTGATCTGGG + Intergenic
1115496335 14:34008239-34008261 TGTTACAAGGATATTTTGCTTGG + Intronic
1116786123 14:49290647-49290669 TGCTCTAGGGATATTTATCTAGG - Intergenic
1116891079 14:50268990-50269012 TGATACAGGGATAAAGATTTAGG + Intronic
1123219712 14:106844325-106844347 CGATATAGGGAAATTGATCTGGG + Intergenic
1128902839 15:71441124-71441146 TGTTTCATGTATAATGATCTGGG + Intronic
1129915553 15:79266888-79266910 TGGTACAGGGACAATGGTCTGGG - Intergenic
1131100076 15:89681218-89681240 TGTTACAGTGGTATCCATCTTGG - Intronic
1131857982 15:96619032-96619054 TGTTACAAAGATAATTATCTGGG - Intergenic
1132990380 16:2789494-2789516 TGTTACTGGCACCTTGATCTTGG - Intergenic
1133329142 16:4960571-4960593 TGTTACAGGCAGATGGTTCTAGG + Intronic
1136699880 16:32124243-32124265 AGTTACAGAGTTATTGGTCTTGG - Intergenic
1146525386 17:33563026-33563048 TGTTGCAGGGAGATTGCTCAAGG + Intronic
1148834846 17:50460623-50460645 GGTTCCAGGGAGACTGATCTGGG + Intronic
1149383694 17:56121078-56121100 AGTCACAGGGATTTTTATCTGGG - Intronic
1150934594 17:69621878-69621900 TATTAAAAGGATATTGATCTAGG - Intergenic
1154179174 18:12115625-12115647 TGTTATAGGGATGTTCATCTCGG + Intronic
1155478144 18:26255949-26255971 TGTAACAAGGAGATTGAGCTGGG + Intronic
1158686247 18:59617160-59617182 TGTTCCAGTGATGATGATCTTGG - Intronic
1159354021 18:67314038-67314060 TGTTACATGGATATATATGTTGG + Intergenic
1159865243 18:73696190-73696212 CGTTACTGGCATATGGATCTTGG - Intergenic
926356916 2:12048900-12048922 GATTCCAGGGATCTTGATCTGGG + Intergenic
926911485 2:17855699-17855721 TGTTTCAGTGTTGTTGATCTGGG + Intergenic
927017472 2:18980113-18980135 TGTTACAGGGAAATTGAAGTTGG + Intergenic
928739157 2:34329346-34329368 TCTTACCAGGATAATGATCTTGG + Intergenic
933111920 2:78412866-78412888 TGTTCCAGGGATGTAGTTCTTGG + Intergenic
933191091 2:79334926-79334948 TGGTTCAGGGATACTGAACTAGG + Intronic
933564417 2:83932283-83932305 TGTATCAGGGGTATTGGTCTCGG - Intergenic
933636649 2:84715576-84715598 TGTTACAGTGAAATTGATAATGG - Exonic
937170411 2:119860392-119860414 TGTCACATGGATATGAATCTTGG + Intronic
937317680 2:120942260-120942282 TGTTCCAGTGATACTGATTTTGG - Intronic
940179848 2:150919602-150919624 TTGTACAGGTATATTCATCTTGG - Intergenic
941428171 2:165376609-165376631 TGTTACTGGGAGTTTAATCTAGG + Intronic
945681479 2:212919112-212919134 TGGGACAGGGTTGTTGATCTAGG - Intergenic
1170731540 20:18979914-18979936 TGTTACAGGAGTATGAATCTTGG + Intergenic
1172057512 20:32164823-32164845 TCTCACAGAGATTTTGATCTTGG - Intronic
1174998391 20:55598737-55598759 TGTTAGATGGATATTGCTCTTGG - Intergenic
1175957244 20:62617654-62617676 AGTTACAGAGATCTGGATCTGGG + Intergenic
1176908254 21:14530553-14530575 TGTTATAGGGATATTTCACTGGG + Intronic
1180704692 22:17801967-17801989 TGTTACCGGCATCTTGAACTGGG + Intronic
951067959 3:18289692-18289714 TGTGACTGGGATATGGATGTAGG - Intronic
951181732 3:19667337-19667359 GGTTGCTGGGCTATTGATCTAGG - Intergenic
955549415 3:60067611-60067633 TGTTTGGTGGATATTGATCTGGG + Intronic
956139932 3:66135928-66135950 TCCTACAGGGATATACATCTTGG + Intronic
957975298 3:87435526-87435548 TGTTACATGCATCTTGGTCTTGG + Intergenic
958786089 3:98597708-98597730 GTTTACATGGATATTGATATGGG - Intergenic
958987843 3:100803251-100803273 TGTTACAGGGATCAAGATCACGG + Intronic
959031241 3:101301150-101301172 TCTTACATGGATATTGTTCATGG + Intronic
961098280 3:124176153-124176175 TGTTTTAGGAAGATTGATCTGGG - Intronic
965078541 3:164008610-164008632 TGTGACAGGAATGTTGAGCTTGG + Intergenic
966789420 3:183652830-183652852 TGCTACAGGGGTATTTGTCTTGG - Intronic
970348060 4:15173255-15173277 TGTTTCAGAAATATTGTTCTGGG + Intergenic
972464512 4:39342144-39342166 AATTACAGGGAAATTGCTCTTGG - Intronic
973695684 4:53488316-53488338 TGTCACAGGGAAATTGATGTGGG - Intronic
973824500 4:54691683-54691705 TGTTAAAAGGATATTGTTTTAGG + Intronic
973864121 4:55094716-55094738 TGTTACAAGGAATTTGATCATGG - Intronic
981383732 4:144102791-144102813 TGGTACAGGAATATTACTCTAGG - Intergenic
982889663 4:160831840-160831862 TGTTACAGGAGAATTGACCTTGG + Intergenic
982940914 4:161552919-161552941 TGTTACAGGCATTTTTAGCTAGG + Intronic
984053681 4:174898992-174899014 TGTTACAAGGAGCTTGATCTGGG + Intronic
984157332 4:176208397-176208419 TATTACAGAAATATTTATCTTGG - Intergenic
984514242 4:180718998-180719020 TTTTGCAGTGATATTGAGCTGGG - Intergenic
985078217 4:186239091-186239113 TGTTACAGGTACAGTGATATAGG + Intronic
986114278 5:4754623-4754645 TGTTACAGGGAGAAGGAACTGGG - Intergenic
986118790 5:4809353-4809375 TGTTATATGGATATTTATGTAGG + Intergenic
986567834 5:9132758-9132780 AGTTACAGGAATATTGATGATGG - Intronic
987539862 5:19240810-19240832 AGTTTCAGGGATACTGTTCTTGG + Intergenic
988233788 5:28512394-28512416 TGATCCAGGGAAATTGATTTGGG - Intergenic
988350552 5:30100721-30100743 TGTTACAGGAACATTTCTCTGGG + Intergenic
989730257 5:44640624-44640646 TGTTTCAGGGGGATTGACCTAGG - Intergenic
990894572 5:60684659-60684681 TGTTTCAAGGACACTGATCTAGG + Intronic
992235591 5:74705827-74705849 TATTACAGGGGTATTAAACTAGG - Intronic
992253413 5:74897904-74897926 TATTACAGGGGTATTAAACTAGG - Intergenic
993250718 5:85518513-85518535 TATTACAAGGACATTGTTCTAGG + Intergenic
993571992 5:89552238-89552260 TTGGACAGTGATATTGATCTAGG - Intergenic
1002372106 5:178763048-178763070 TGTTACCTGGATAATGATTTAGG - Intergenic
1007228983 6:40334993-40335015 TTTCACAGGAAGATTGATCTGGG + Intergenic
1007874762 6:45084039-45084061 TGTTTCATGGATATTCTTCTAGG - Intronic
1009566063 6:65312822-65312844 GGTTACAGGAACATTGAACTAGG - Intronic
1010110894 6:72229786-72229808 TTTTACAGGGATATTCATTTGGG - Intronic
1011566099 6:88674048-88674070 TGTTACAGGGATATTAAAAATGG + Intronic
1011930772 6:92709380-92709402 TATTCAAGGGATTTTGATCTGGG + Intergenic
1012085111 6:94814942-94814964 TGTTGCATGGTTATTGTTCTTGG - Intergenic
1016001432 6:139045310-139045332 AGTTTCAGGGAGTTTGATCTGGG + Intergenic
1017878557 6:158543873-158543895 TGATACAGGGCTATGGATTTTGG + Intronic
1019957242 7:4425075-4425097 TGTTACATGGATGTTGAACCAGG + Intergenic
1028217206 7:88148482-88148504 TTTTACATGGATTTAGATCTTGG - Intronic
1030661418 7:112223327-112223349 TGTTCCAGGAACACTGATCTAGG + Intronic
1031313268 7:120226506-120226528 TATTACAGTAAGATTGATCTAGG + Intergenic
1032271816 7:130415524-130415546 TGTTCCAAGGGTATTGTTCTGGG + Intronic
1033831534 7:145260046-145260068 TGATACAGGGATATTGAAGCTGG + Intergenic
1038030586 8:23635071-23635093 TGTTACAAGGAGATTGAGCTGGG + Intergenic
1038129587 8:24715092-24715114 TGTAACAGGGAAATAGATGTGGG - Intergenic
1041765367 8:61413168-61413190 TGGGACTGGGATATAGATCTTGG - Intronic
1042053646 8:64738796-64738818 TGTTTCAGGTAAACTGATCTTGG - Intronic
1042717596 8:71791263-71791285 TGTTACATTTATAATGATCTCGG + Intergenic
1043548346 8:81340100-81340122 AGGGACAGGGATATTGATGTCGG + Intergenic
1043801240 8:84612799-84612821 TGTTCCAAGGATATTGAACTTGG - Intronic
1044364494 8:91326955-91326977 TCTTACAAGGATACTGATCATGG + Intronic
1045623902 8:104018839-104018861 TGTTAGAGTAATATTGAACTGGG - Intronic
1045768182 8:105702340-105702362 TATTACAGGGAGATTTATCTTGG + Intronic
1047253534 8:123198571-123198593 TGTTAAAGGGAAGTTTATCTTGG - Intronic
1047330518 8:123882937-123882959 TGGTGCAGGGATATTGATGATGG + Intronic
1051303854 9:15686255-15686277 TTTTGGAGGCATATTGATCTGGG + Intronic
1054529907 9:66171398-66171420 TGTTTGAGGGACATTGATCAAGG - Intergenic
1054777975 9:69139815-69139837 TGCTACAGAGCTATTGCTCTTGG - Intronic
1054941502 9:70747793-70747815 TGTTAGGGGGATATTGGACTAGG + Intronic
1059281705 9:113139604-113139626 TGTTTCAGGGACATTGAACAAGG - Intergenic
1059522832 9:114959829-114959851 TGTTACAGGCAGATAGATATGGG + Intergenic
1194837624 X:98700232-98700254 TGCTACAGGGAGATGGATTTTGG - Intergenic
1197813292 X:130469319-130469341 TCTGACAGAGAAATTGATCTAGG - Intergenic
1201503468 Y:14672039-14672061 TGTTACAGGGAAATTACTCAAGG + Intronic
1202075446 Y:21033269-21033291 TGTTCCAGGGCTATTGATGATGG + Intergenic