ID: 1069906380

View in Genome Browser
Species Human (GRCh38)
Location 10:71734876-71734898
Sequence GCCCCGGTAGGGTCTTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069906370_1069906380 7 Left 1069906370 10:71734846-71734868 CCTCCAACTCTGTCCTCTGTGTC 0: 1
1: 0
2: 3
3: 51
4: 525
Right 1069906380 10:71734876-71734898 GCCCCGGTAGGGTCTTGGGTGGG No data
1069906364_1069906380 29 Left 1069906364 10:71734824-71734846 CCCCTCTGGGGCATGTCCCCTGC 0: 1
1: 1
2: 1
3: 30
4: 227
Right 1069906380 10:71734876-71734898 GCCCCGGTAGGGTCTTGGGTGGG No data
1069906366_1069906380 27 Left 1069906366 10:71734826-71734848 CCTCTGGGGCATGTCCCCTGCCT 0: 1
1: 1
2: 1
3: 34
4: 286
Right 1069906380 10:71734876-71734898 GCCCCGGTAGGGTCTTGGGTGGG No data
1069906368_1069906380 12 Left 1069906368 10:71734841-71734863 CCCTGCCTCCAACTCTGTCCTCT 0: 1
1: 2
2: 6
3: 171
4: 2006
Right 1069906380 10:71734876-71734898 GCCCCGGTAGGGTCTTGGGTGGG No data
1069906371_1069906380 4 Left 1069906371 10:71734849-71734871 CCAACTCTGTCCTCTGTGTCTTG 0: 1
1: 0
2: 4
3: 50
4: 438
Right 1069906380 10:71734876-71734898 GCCCCGGTAGGGTCTTGGGTGGG No data
1069906369_1069906380 11 Left 1069906369 10:71734842-71734864 CCTGCCTCCAACTCTGTCCTCTG 0: 1
1: 1
2: 5
3: 81
4: 730
Right 1069906380 10:71734876-71734898 GCCCCGGTAGGGTCTTGGGTGGG No data
1069906367_1069906380 13 Left 1069906367 10:71734840-71734862 CCCCTGCCTCCAACTCTGTCCTC 0: 1
1: 0
2: 3
3: 124
4: 939
Right 1069906380 10:71734876-71734898 GCCCCGGTAGGGTCTTGGGTGGG No data
1069906365_1069906380 28 Left 1069906365 10:71734825-71734847 CCCTCTGGGGCATGTCCCCTGCC 0: 1
1: 2
2: 2
3: 24
4: 222
Right 1069906380 10:71734876-71734898 GCCCCGGTAGGGTCTTGGGTGGG No data
1069906372_1069906380 -6 Left 1069906372 10:71734859-71734881 CCTCTGTGTCTTGCCTAGCCCCG 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1069906380 10:71734876-71734898 GCCCCGGTAGGGTCTTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069906380 Original CRISPR GCCCCGGTAGGGTCTTGGGT GGG Intronic
No off target data available for this crispr