ID: 1069907229

View in Genome Browser
Species Human (GRCh38)
Location 10:71738985-71739007
Sequence CAGCAAGCGCCTCCTGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069907229_1069907234 11 Left 1069907229 10:71738985-71739007 CCCATGGCAGGAGGCGCTTGCTG No data
Right 1069907234 10:71739019-71739041 TTGGACACCCCAGAGTGCAGAGG No data
1069907229_1069907235 12 Left 1069907229 10:71738985-71739007 CCCATGGCAGGAGGCGCTTGCTG No data
Right 1069907235 10:71739020-71739042 TGGACACCCCAGAGTGCAGAGGG No data
1069907229_1069907232 -8 Left 1069907229 10:71738985-71739007 CCCATGGCAGGAGGCGCTTGCTG No data
Right 1069907232 10:71739000-71739022 GCTTGCTGTCGCTCCAGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069907229 Original CRISPR CAGCAAGCGCCTCCTGCCAT GGG (reversed) Intronic
No off target data available for this crispr