ID: 1069908215

View in Genome Browser
Species Human (GRCh38)
Location 10:71744577-71744599
Sequence GGAATGCTTATGCTCCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069908215_1069908220 7 Left 1069908215 10:71744577-71744599 CCCTTGGGGAGCATAAGCATTCC No data
Right 1069908220 10:71744607-71744629 CATGTCAGCCCCTGACATTCTGG No data
1069908215_1069908225 24 Left 1069908215 10:71744577-71744599 CCCTTGGGGAGCATAAGCATTCC No data
Right 1069908225 10:71744624-71744646 TTCTGGTTCTCACTGAAGCAGGG No data
1069908215_1069908224 23 Left 1069908215 10:71744577-71744599 CCCTTGGGGAGCATAAGCATTCC No data
Right 1069908224 10:71744623-71744645 ATTCTGGTTCTCACTGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069908215 Original CRISPR GGAATGCTTATGCTCCCCAA GGG (reversed) Intronic
No off target data available for this crispr