ID: 1069909999

View in Genome Browser
Species Human (GRCh38)
Location 10:71753104-71753126
Sequence GAGCTGTGCAGGGCCCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 293}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069909999_1069910006 2 Left 1069909999 10:71753104-71753126 CCCAGGAGGGCCCTGCACAGCTC 0: 1
1: 0
2: 5
3: 37
4: 293
Right 1069910006 10:71753129-71753151 GACTCCATTTCTTTTCACATGGG 0: 1
1: 0
2: 3
3: 20
4: 227
1069909999_1069910005 1 Left 1069909999 10:71753104-71753126 CCCAGGAGGGCCCTGCACAGCTC 0: 1
1: 0
2: 5
3: 37
4: 293
Right 1069910005 10:71753128-71753150 GGACTCCATTTCTTTTCACATGG 0: 1
1: 0
2: 2
3: 17
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069909999 Original CRISPR GAGCTGTGCAGGGCCCTCCT GGG (reversed) Intronic
900115181 1:1025228-1025250 GAGCTGGGCAGGGCCGGGCTGGG - Intronic
900290580 1:1921983-1922005 AGGCTGTGGAGGGCTCTCCTGGG + Exonic
900402768 1:2479381-2479403 GAGGTGTCCAGGGGCTTCCTTGG + Intronic
900617457 1:3571787-3571809 CAGGTGTGCTGGGTCCTCCTGGG + Intronic
900617485 1:3571882-3571904 CAGGTGTGCTGGGTCCTCCTGGG + Intronic
900617556 1:3572153-3572175 CAGGTGTGCTGGGTCCTCCTGGG + Intronic
900617579 1:3572250-3572272 CAGGTGTGCTGGGTCCTCCTGGG + Intronic
900617606 1:3572346-3572368 CAGGTGTGCTGGGTCCTCCTGGG + Intronic
900617615 1:3572384-3572406 CAGGTGTGCTGGGTCCTCCTGGG + Intronic
900617624 1:3572422-3572444 CAGGTGTGCTGGGTCCTCCTGGG + Intronic
900787143 1:4655962-4655984 GGGCTGAGCAGGGGCCTCCCAGG + Intronic
901172121 1:7266768-7266790 GAGCTGGGCAGGGCTTTCTTGGG + Intronic
902629264 1:17695119-17695141 CGGCTGAGCAGTGCCCTCCTGGG - Intronic
902809888 1:18882069-18882091 GGGCTGTGCCGTGGCCTCCTTGG - Intronic
903016513 1:20365548-20365570 CAGCTGTGCAGGGACCTCCTGGG - Intergenic
903227100 1:21900020-21900042 GAGCTGCTAATGGCCCTCCTTGG - Intronic
903384356 1:22916834-22916856 GAGCTGTGCAGCGCCAGGCTGGG + Intergenic
904472245 1:30743061-30743083 ATGCTCTCCAGGGCCCTCCTGGG - Intronic
904837639 1:33349594-33349616 GACCTGTCCAGGGCCCGGCTGGG + Intronic
904888327 1:33758931-33758953 CAGCTCTGCAGGGCTCTCCTGGG - Intronic
905773473 1:40653428-40653450 GAGCTGGGCAGGCCTCTTCTCGG - Intronic
906148135 1:43572035-43572057 GAGCTGTGCTGACCCGTCCTTGG + Intronic
908823444 1:68111993-68112015 AAGCTAAGCAGTGCCCTCCTTGG + Intronic
915553215 1:156646915-156646937 GGGCTGTGCTGGGCTCTCCGCGG + Exonic
915623073 1:157098011-157098033 GAGGTGTGATGGGCTCTCCTTGG + Intronic
919668254 1:200313586-200313608 GAGATGTTCAGGGCCCTTCCTGG + Intergenic
920279214 1:204830154-204830176 GAAATGTGCTGGGCCCTGCTGGG + Intronic
920311828 1:205053045-205053067 GAGCTGGGAGGGGCGCTCCTCGG + Intronic
920821907 1:209389316-209389338 GAGATATGCAGGGCTCTCCATGG + Intergenic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
922675776 1:227547986-227548008 GAGCTGTGAGTGGCCCTCCTAGG - Intergenic
924034821 1:239925107-239925129 GAGCTGTGCAGGGCGCTTGCGGG - Intergenic
1063137373 10:3229335-3229357 GTGCTGTGCAGGGCCTCCCCGGG + Intergenic
1066682009 10:37943522-37943544 GAGCTGTGCATAACCCTCTTTGG - Intergenic
1069689489 10:70340535-70340557 GAGCTGACCAGGGCCTACCTCGG + Exonic
1069909999 10:71753104-71753126 GAGCTGTGCAGGGCCCTCCTGGG - Intronic
1070853212 10:79584342-79584364 GAGGTTTGCAGGGCCCTCCTGGG - Intergenic
1070887872 10:79920964-79920986 GAGGTTTGCAGGGCCCTCCTGGG + Intergenic
1071346362 10:84697807-84697829 GGGGTGAGCAGGGCCCTTCTGGG + Intergenic
1072618477 10:97064756-97064778 GGGGTGTGGAGGGCCCTGCTAGG - Intronic
1072640097 10:97205319-97205341 GAGCTGTATAGGGCCCTGCTGGG - Intronic
1072882067 10:99237270-99237292 GAAGCGTCCAGGGCCCTCCTTGG + Intergenic
1073268609 10:102243103-102243125 GAGGTGTGCAGGACACTACTAGG - Intergenic
1074643545 10:115417517-115417539 TATCTGTGCAGGGACCTGCTAGG + Intronic
1075215227 10:120526854-120526876 AAGCTCTGCAGGGCCCTGCCTGG + Intronic
1075995479 10:126873274-126873296 GAGGTGTGCAGGGTGATCCTGGG + Intergenic
1076272170 10:129163200-129163222 GTGCTGTGCAGGTGCCTCATGGG + Intergenic
1076306693 10:129470188-129470210 GAGCTGTGCAGGAGGGTCCTTGG + Intronic
1076500647 10:130933578-130933600 GAGTTGTGCAGGGCCCACCCTGG - Intergenic
1076785034 10:132745509-132745531 CATCTGTGCTGGGCCCTGCTGGG + Intronic
1076806504 10:132861808-132861830 GACCTGGGCAGGCCCCTCCCAGG + Intronic
1077043405 11:534379-534401 TGGCTGAGCAGGGCCCTCCTTGG - Intronic
1077153875 11:1083029-1083051 GGGCTGAGAAGGGCCCCCCTCGG - Intergenic
1077182886 11:1224402-1224424 GCTCCGTGCAGTGCCCTCCTTGG - Intronic
1077359609 11:2134857-2134879 GAGCGGTGCATGCGCCTCCTTGG - Intronic
1077364582 11:2156422-2156444 GGGCTGTGGGGGGCCCTGCTGGG - Intronic
1077411638 11:2406482-2406504 GACCTGTGCAGGACCCTGCTGGG - Intronic
1077504524 11:2923939-2923961 GAGCTGGCCAGGCCCCACCTGGG - Intronic
1080681686 11:34482740-34482762 GGTCCGTGCAGGGCCTTCCTAGG + Intronic
1080870099 11:36229336-36229358 GGGCTCAGCAGTGCCCTCCTGGG - Exonic
1081649438 11:44813822-44813844 GAGCAGCACAGAGCCCTCCTGGG + Intronic
1082091829 11:48096639-48096661 GAGCTGTTGAGGCCCTTCCTGGG + Intronic
1082775348 11:57240520-57240542 GAGTTGTGCAGGGACCAGCTTGG + Intergenic
1083424717 11:62577274-62577296 GAGTTATGCAGGGCCAGCCTGGG + Exonic
1083901571 11:65645997-65646019 GGGCCATGCAGGGCCCTCCATGG - Intronic
1084007770 11:66332318-66332340 TGGCTGAGCAGGGCCTTCCTGGG + Exonic
1084422271 11:69066330-69066352 GAGCTAGGCGGGCCCCTCCTGGG - Intronic
1085886992 11:80533082-80533104 GGGCTGTGCGCGGCCCTCATGGG - Intergenic
1089289197 11:117427577-117427599 GAGCTGTGCTGGGCCCGCAAGGG - Intergenic
1090224790 11:125063446-125063468 GAGGCGTGCCGGGACCTCCTGGG + Intronic
1090240671 11:125179393-125179415 GAGCAGGGCAGGGCCTCCCTGGG + Intronic
1090876826 11:130797675-130797697 GAGCTGTACAGTGCTCTCCCTGG - Intergenic
1090967872 11:131614307-131614329 GAACTCTGCACGGCCCTTCTGGG - Intronic
1093296909 12:17402518-17402540 GAGCTGTGCTGTGACCACCTTGG + Intergenic
1096157539 12:49348907-49348929 GGGCTGTGGGGGGCCCTGCTGGG + Exonic
1096476129 12:51910307-51910329 TTGCTGTACAGGGCCCTGCTGGG - Intronic
1098268353 12:68746245-68746267 GATCTGTGCATGCCACTCCTGGG + Exonic
1099337390 12:81380710-81380732 GATCTATGCAGTTCCCTCCTCGG - Intronic
1100828552 12:98497137-98497159 GTGCTGTGGATGGCACTCCTTGG - Intronic
1102812674 12:115837960-115837982 GAGCCTTGCTGAGCCCTCCTGGG + Intergenic
1102962192 12:117099903-117099925 GGGCTGTGCAGGGCCCACACGGG - Intergenic
1103289722 12:119835337-119835359 GCACTGTGCCAGGCCCTCCTAGG - Intronic
1104897517 12:132171593-132171615 GAGTAGAGCAGGGCCCTCCCAGG + Intergenic
1104973530 12:132541986-132542008 CACCTGTGCTGGGCCCTCGTGGG - Intronic
1105593860 13:21817969-21817991 GGGCTGTGCAGGGCACTCATGGG + Intergenic
1105950527 13:25225653-25225675 TGGCTGTGCAGAGCCCTCCTGGG + Intergenic
1107132389 13:36910644-36910666 GAGCTGCACAGGGGCCTTCTGGG - Intronic
1108720603 13:53127571-53127593 GAGCTGTCCATGTCCCTACTAGG - Intergenic
1108855508 13:54787978-54788000 GGGCTGTGCATGGCGCTCGTGGG - Intergenic
1109534116 13:63693882-63693904 GGGCTGTGCATGGCTCTCCTGGG - Intergenic
1110048539 13:70861705-70861727 GTGTTGTGCAGGAACCTCCTGGG - Intergenic
1111894586 13:94125619-94125641 CAGCAGTGCAGGTCTCTCCTGGG - Intronic
1113508235 13:110831649-110831671 GAGCTGGGCAGAGGCCTCCATGG - Intergenic
1113778850 13:112964132-112964154 GGGCTGTGCATAGCCCACCTCGG + Intronic
1113891728 13:113739557-113739579 GAACTGGGCAGGGCCCGCCGGGG - Intergenic
1113905710 13:113818274-113818296 GGGCAGTGCAGGGCTCTCCTGGG + Intergenic
1113909583 13:113835875-113835897 GAGCTGGGAAGGGCCCTGCTTGG + Intronic
1117543851 14:56774679-56774701 CACCTCTGCAGGGCCTTCCTGGG + Intergenic
1119480239 14:74954267-74954289 GGGCTGTGCAGGGCCCAGCAGGG - Intronic
1120170869 14:81246604-81246626 GAGCTGTGCTGGCACCTCCCAGG - Intergenic
1120497569 14:85255871-85255893 GGGCTGTGGAGGGCCCGCCTGGG + Intergenic
1120955670 14:90079813-90079835 GAGCTCTGCAGGCCCTGCCTGGG + Intronic
1121518227 14:94568055-94568077 CTGCTGGGCAGAGCCCTCCTTGG - Intronic
1122504702 14:102224984-102225006 TAGCTGTTTTGGGCCCTCCTGGG - Intronic
1122972304 14:105157323-105157345 GGGCTCTGCAGGGCCCTGCAGGG - Intronic
1123054229 14:105561658-105561680 GGGCTCTGGAGGGCCCTCCTGGG - Intergenic
1123078813 14:105682077-105682099 GGGCTCTGGAGGGCCCTCCTGGG - Intergenic
1123130942 14:105984800-105984822 GAGATGTGCATGGCCTGCCTGGG + Intergenic
1123581170 15:21716021-21716043 GAGATGTGCATGGCCTGCCTGGG + Intergenic
1123617819 15:22158644-22158666 GAGATGTGCATGGCCTGCCTGGG + Intergenic
1125515797 15:40320311-40320333 GAGATGTGCAGGGGCCCACTAGG - Intergenic
1125715350 15:41816863-41816885 GGGCTGTTCAGGGCACTCATGGG + Intronic
1126670390 15:51110640-51110662 GTGCTTTCCAGGGCCCTCCCTGG + Intergenic
1129207523 15:74045771-74045793 GAGTAGTGCTGGGCACTCCTTGG - Exonic
1129316921 15:74750671-74750693 GAGGTGTCCAGAGCCTTCCTAGG - Intronic
1129669978 15:77602208-77602230 GCCCTGTGCTGGGCCCTCCAGGG - Intergenic
1129799887 15:78405864-78405886 GGGCAGTGCAGGGCCTTCCCAGG - Intergenic
1132507880 16:321362-321384 GTGCTATGCAGAGCTCTCCTGGG - Intronic
1132656701 16:1044495-1044517 GAGCTGTCCTGGCCCCACCTCGG - Intergenic
1133128439 16:3662016-3662038 GAGCTGTGCGCGCTCCTCCTGGG + Exonic
1137070141 16:35897931-35897953 GAGCTGTGCATAAACCTCCTTGG + Intergenic
1139373369 16:66481663-66481685 TAGATGGGCAGGGCCCTCCGTGG + Exonic
1139557867 16:67724096-67724118 CAGCTGTCCCGAGCCCTCCTGGG + Exonic
1140058912 16:71550256-71550278 CAGCTAAGCAGAGCCCTCCTGGG + Intronic
1141432484 16:83977592-83977614 GAGCTGTGGAGGCCCCTCTGTGG + Intronic
1141957864 16:87384341-87384363 GAGCTCTGCAGGGACCTTCGGGG + Intronic
1142310151 16:89307570-89307592 CAGCAGTGCAGGTCCCTCCCGGG + Intronic
1142478311 17:202764-202786 GAGCTGTGCCAGGCGCACCTGGG - Intergenic
1145018014 17:19411497-19411519 GGGGTGGGAAGGGCCCTCCTTGG + Intronic
1145814057 17:27782844-27782866 GAGCTGTGCCCAGGCCTCCTGGG - Intronic
1145901888 17:28495034-28495056 GATCGGTGCAGGGGACTCCTGGG + Intronic
1150624604 17:66833736-66833758 GAGCTGTGCAAGAGGCTCCTGGG + Intergenic
1151323324 17:73364423-73364445 GGGGGGTGCAGGGACCTCCTTGG + Intronic
1151969880 17:77452098-77452120 GATATGTGCAGGGCGTTCCTGGG + Intronic
1152007542 17:77691911-77691933 AAGGTGTGCAGGGCTCTCCCCGG + Intergenic
1152204454 17:78967158-78967180 GAGCTGAGCAGGGCCCTCTTTGG + Intergenic
1152310736 17:79548228-79548250 GAGCCAGGCTGGGCCCTCCTGGG - Intergenic
1152371507 17:79891334-79891356 GAGCTGTCCAGGGCCTCCCGAGG - Intergenic
1152766188 17:82140782-82140804 GCGCTGTGCCGGGTTCTCCTTGG - Intronic
1152806444 17:82359103-82359125 GGGCTGCACATGGCCCTCCTTGG + Intergenic
1153387102 18:4510588-4510610 TAGGTGGGCAGGGCCCTCGTGGG + Intergenic
1153545112 18:6196998-6197020 AAGCTGTTCAGGGCCCTGCTTGG - Intronic
1154133891 18:11759717-11759739 GAGCTCTGCATGGCACTCCCTGG - Intronic
1154163364 18:11996248-11996270 GAGCTGTGAAGGGCTCGCCCTGG + Intronic
1157932907 18:51842741-51842763 GAGCTGAGCTGGGCCAGCCTGGG + Intergenic
1159014645 18:63091137-63091159 CAGCTGGGCAGGGCCCAGCTAGG + Intergenic
1159879694 18:73846566-73846588 GAGCTGTGCAGGCACATACTTGG - Intergenic
1160053589 18:75459211-75459233 CAGCTGTTCTTGGCCCTCCTTGG - Intergenic
1160106908 18:75986947-75986969 GAGATATGCAGGGCCCGCCCTGG - Intergenic
1160199468 18:76784025-76784047 GAGCTGGCCAGGCCCCTCCTGGG + Intergenic
1160372932 18:78389828-78389850 GAGGTGAGCACGGGCCTCCTGGG - Intergenic
1160562337 18:79766570-79766592 GGGCAGCACAGGGCCCTCCTGGG - Intergenic
1160718286 19:586248-586270 GAGCTGTGCATGGCAGGCCTGGG - Intergenic
1160791319 19:925091-925113 GAGACGTGCAGGGACCTCCCTGG + Intergenic
1160857114 19:1222583-1222605 GAGCTGTGCAGAGACCCCCAAGG - Intronic
1160867714 19:1263047-1263069 TGGCTGTGCAGGCCCCTCGTGGG - Intronic
1160980477 19:1814481-1814503 CATCTCTCCAGGGCCCTCCTGGG - Intergenic
1161067397 19:2245469-2245491 GGGCTGGGCAGGGGCCTCCTTGG - Exonic
1161310310 19:3590196-3590218 GGGCTGTGCTGGGCCCCCCCAGG - Exonic
1161837348 19:6656988-6657010 GAGCTGTGTGTAGCCCTCCTTGG + Intergenic
1162141931 19:8590214-8590236 GAGCTGGGCAGGACACACCTGGG + Intronic
1163469434 19:17487905-17487927 GACCTGTGCCAGCCCCTCCTCGG + Intronic
1164062644 19:21689062-21689084 GAGCTGCGCATAACCCTCCTTGG + Intergenic
1165861467 19:38911578-38911600 GAGCAGTGCAGGGTCCTCTCTGG + Exonic
1167036936 19:47000280-47000302 GAACTGTGCAGGGCCCCACCTGG - Intronic
926324254 2:11770809-11770831 TCGATGTTCAGGGCCCTCCTTGG + Intronic
927844126 2:26462602-26462624 GATCTGAGCATGGCTCTCCTGGG + Intronic
928392645 2:30921155-30921177 GAGCATTGCAGGGCCCCTCTCGG + Intronic
931643427 2:64400982-64401004 GATCTGGGCAGGGCCCTGCTAGG + Intergenic
933806476 2:86001584-86001606 GTGCTGTGAAGGCACCTCCTGGG - Intergenic
934568093 2:95351690-95351712 GAGGTCTGCAGGGACCTCCCTGG + Intronic
934736761 2:96693561-96693583 GAGCTCTGCAGGCCCCACATGGG + Intergenic
934774103 2:96926439-96926461 TAGCTGTGCATGGTCCTCCAAGG - Intronic
937913042 2:127085503-127085525 CACCTGTTCATGGCCCTCCTGGG + Intronic
938421982 2:131153541-131153563 GAACTGGGCAGGGCCTGCCTGGG - Intronic
938691994 2:133800308-133800330 CAGGTGAGCAAGGCCCTCCTTGG - Intergenic
946392511 2:219425298-219425320 AATGTGTGCAGGGCTCTCCTGGG + Intronic
946432491 2:219633025-219633047 GAGCTGGACAGGCCCCTCCCAGG - Intronic
947733059 2:232441588-232441610 GACCTGGGCCGGGCCCCCCTGGG + Intergenic
948057467 2:235019232-235019254 GTGCCCTGCAGCGCCCTCCTGGG - Intronic
948793366 2:240390442-240390464 GAGCTGTCCAGGCCACTCCTGGG - Intergenic
948884247 2:240874981-240875003 CAGCTGGGGCGGGCCCTCCTGGG + Intronic
1168773789 20:432438-432460 GAGCTGTGTAGGGCCAACCCCGG + Intergenic
1171220675 20:23394072-23394094 GAGCTGTGCAGAGCCTTCATGGG - Intronic
1171266665 20:23776626-23776648 GAAAAGTGCAGGGCCCTCCTGGG + Intergenic
1173298797 20:41782347-41782369 CCTCTGTGCAGGGCCCTCCCTGG - Intergenic
1173726440 20:45301471-45301493 GAGCTGAGAAGGGCAGTCCTGGG - Intronic
1174134242 20:48367950-48367972 GAGCTGGGCAGAGCCCGCCTCGG - Intergenic
1174361477 20:50031499-50031521 GAGCTCTCCACGGTCCTCCTGGG + Intergenic
1174519570 20:51119173-51119195 CAGCCCAGCAGGGCCCTCCTAGG - Intergenic
1175399529 20:58692728-58692750 GAGACGTGCAGGGCCCGCCCGGG - Exonic
1175399811 20:58693616-58693638 GAGCTGCGCAGTGCCCTTCCAGG + Intronic
1175832832 20:61976484-61976506 GTGCTGTCCAGGGCCCTGCCAGG + Intronic
1176276916 20:64277929-64277951 CAGCTGCCCAGGGCCCTCCTAGG - Intronic
1176276939 20:64278013-64278035 CAGCTGCCCAGGGCCCTCCTAGG - Intronic
1178505947 21:33163123-33163145 GGGATGTTCAGGGCCCTCCATGG - Intergenic
1178583902 21:33857392-33857414 GAGGTGGCCAGGGCCCTTCTGGG - Intronic
1178918457 21:36722775-36722797 GAGCTCTGCAGGGCCCATCAGGG + Intronic
1180160700 21:45997626-45997648 GAGGGAAGCAGGGCCCTCCTGGG - Intronic
1180162453 21:46004295-46004317 CACCTGTGCAGGGCCCTCTGGGG + Exonic
1180191722 21:46168518-46168540 GGGCTGTGCAGCCCCCTCCCAGG - Exonic
1181080068 22:20408012-20408034 GGGCTGGGCAGGGCCACCCTGGG + Exonic
1181106401 22:20578390-20578412 GAGCTGGGGAGGGCCCTCTGCGG - Intronic
1181634685 22:24169108-24169130 GAGTTGGGGAGGCCCCTCCTGGG + Intronic
1182231439 22:28840289-28840311 TAGATGTGCAGGGCCCTCTGAGG + Intergenic
1182685462 22:32119659-32119681 GAGCACTGCAGGGCCAGCCTGGG - Intergenic
1183513612 22:38250317-38250339 GAAATGTACAGGGCTCTCCTAGG - Intronic
1183583940 22:38741307-38741329 GAGCTGTGCAGGGGCTCCCTGGG - Intronic
1183618477 22:38959272-38959294 GAGAGGAGCAGGGTCCTCCTCGG + Intronic
1184089220 22:42283661-42283683 GGGCTGGGCAGGGGCCTCCCGGG - Intronic
1184094806 22:42310829-42310851 AGGCTCTGCGGGGCCCTCCTGGG - Intronic
1184423389 22:44395023-44395045 GAGCAGTGCTTGGCCCTCATTGG - Intergenic
1185138917 22:49089450-49089472 GGGCTGTGCTGGGCCCACCCTGG - Intergenic
1185138927 22:49089488-49089510 CTGCTGTGAAGGGGCCTCCTTGG + Intergenic
1185233742 22:49699297-49699319 GAGCTGAGCAGGGCCCCACAGGG + Intergenic
1185373348 22:50470855-50470877 GAGGGCTGCAGGGCCCTCCATGG - Intronic
950143487 3:10631646-10631668 GACTTGTGCAGGGCCAGCCTGGG - Intronic
950497635 3:13343481-13343503 GAGGTGGGCAGGGCACTACTTGG - Intronic
951320496 3:21238615-21238637 GAGCTGTGCAGCTCCCTGCCTGG - Intergenic
953992988 3:47498266-47498288 CAGGTATGCAGGGGCCTCCTGGG - Exonic
954418302 3:50405058-50405080 GAGCTGAGAAGGGCCCGCTTAGG - Intronic
954669147 3:52278791-52278813 GAGACGTGCAGGGCCTTCCCGGG + Intronic
954799966 3:53181356-53181378 GAGCTGTCCAGGACCACCCTGGG + Intronic
955224698 3:57051082-57051104 GTGCTGTGCCTGGCCCTGCTGGG - Intronic
955409541 3:58646916-58646938 GAGGTTTCCAGGGCCCTCCCTGG + Intronic
962818135 3:139020672-139020694 GCGCTGTGGACGGCGCTCCTGGG + Exonic
963781671 3:149492617-149492639 GGGCTATGCATGGCACTCCTGGG + Intronic
968192222 3:196676892-196676914 GAGCTAAGCATTGCCCTCCTGGG + Intronic
968542250 4:1173448-1173470 GTGCGGTGCAGAGCCCTCCCAGG + Intronic
968649119 4:1753469-1753491 GAGCAGTGCTGGCCCCACCTGGG + Intergenic
969365553 4:6692303-6692325 GAGCTGGGCAGTTCCCTCTTGGG - Intergenic
969369736 4:6724066-6724088 GAGCTGGCCAGGCCCCTCTTGGG - Intergenic
969416126 4:7060609-7060631 GAGCTCAGCAGGGCCCTGCCTGG - Exonic
969507398 4:7596804-7596826 GAGCAGTCCAAGCCCCTCCTAGG - Intronic
969608895 4:8216289-8216311 CAGCTGTGCGGGGCACTCCCGGG + Intronic
974187986 4:58465144-58465166 GGGCTGTGCACGGCGCTCATGGG + Intergenic
975219694 4:71799882-71799904 CAGCTGTGAGGAGCCCTCCTGGG + Intronic
983877774 4:172896943-172896965 CATCTGTGCAGGGACCTGCTGGG - Intronic
984138387 4:175970968-175970990 GAGCAGCGCAGAGCGCTCCTGGG + Intronic
985169002 4:187128283-187128305 GAGCCGTGCAGGCCCGTTCTTGG + Intergenic
985889561 5:2705213-2705235 GGGCTCTGCAGGGCTCCCCTGGG + Intergenic
990511110 5:56489831-56489853 GGGCTGTGCATCGCCTTCCTGGG + Intergenic
991614011 5:68477134-68477156 GAGCTCTGCTGGGCCCTCCATGG - Intergenic
992039474 5:72816296-72816318 AGACTGTGCTGGGCCCTCCTAGG - Exonic
992081155 5:73234875-73234897 GTACTGTGCTGGGCCCTGCTTGG + Intergenic
997790064 5:136750892-136750914 GAGCTGTGCAGGAGCCTCACTGG + Intergenic
998107002 5:139475107-139475129 GTGCTGTCCAAGGCCCTCCAGGG + Intergenic
998142773 5:139709498-139709520 GGGCTGTGCAGGGCCCGGCGGGG + Intergenic
998816271 5:146017377-146017399 CACATGTGCAGGGCCCTCCCTGG + Intronic
998912429 5:146974493-146974515 GAGTTGTACAGAGCCCTCCTAGG - Intronic
999129878 5:149274045-149274067 GAGCAGGTCAGAGCCCTCCTAGG - Intronic
1002422164 5:179154412-179154434 CAGGTGTGCATGCCCCTCCTGGG - Intronic
1002427898 5:179186567-179186589 GAGGCCTGCAGGGCCCACCTGGG + Intronic
1002450786 5:179317423-179317445 GAACTGTGCTGTGGCCTCCTGGG - Intronic
1002634422 5:180600075-180600097 GAGCTGTGTAGGGCCCTCCCGGG + Intergenic
1002928792 6:1619841-1619863 GGGCTGTGCAGCTTCCTCCTAGG + Intergenic
1003399112 6:5776928-5776950 GAGCAGTGCATTGCCCTCCACGG + Intergenic
1003908034 6:10720325-10720347 GCGCTGTGCGGGGCCCTCCCTGG - Intergenic
1006385989 6:33731203-33731225 GTCCTGTGCAGGGCCCTTTTGGG + Intronic
1007585995 6:42989801-42989823 GGGCTGTCCAGGTCCCTCCCAGG - Intronic
1013247256 6:108298598-108298620 GAGCTGTACATGGCCCTTATTGG + Intronic
1013585602 6:111575749-111575771 CAGCTCTGCAGGGCACTCCAAGG + Exonic
1014694219 6:124598623-124598645 CACCTATCCAGGGCCCTCCTCGG - Intronic
1017319717 6:153075660-153075682 TAGATGTGCAGTGCCCTCCAGGG - Intronic
1017485770 6:154900738-154900760 GATCTGAACAGGGCTCTCCTCGG + Intronic
1017946584 6:159100967-159100989 CAGCTGGGCAGGGCCCTCAAGGG - Intergenic
1018235694 6:161721632-161721654 CACCTGTTCAGGGCCCTCTTTGG + Intronic
1018995535 6:168707062-168707084 GAGCTGTGCAGACCACTCCTGGG + Intergenic
1019128735 6:169858792-169858814 GAGCTGTGCCAGGGCCTGCTGGG + Intergenic
1019148856 6:169991055-169991077 GGGCTGTTCAGGGTCCTCGTGGG + Intergenic
1019285133 7:219559-219581 TGGCTGTGCAGACCCCTCCTGGG + Intronic
1019518774 7:1451280-1451302 GGGCTGGGCTGGGGCCTCCTGGG - Intronic
1019519288 7:1453433-1453455 GAGCAGGGCTGGGCCCTCCTGGG - Intronic
1019631554 7:2052399-2052421 GAGCTGTCCGGCGCCCTCCTGGG - Intronic
1019708555 7:2507930-2507952 GACCTGGGAGGGGCCCTCCTTGG + Intergenic
1019933876 7:4241925-4241947 GTGCTGTGCTGCGCCCACCTGGG + Intronic
1019993898 7:4711087-4711109 CAGCTGTGCAGGGCCAAGCTGGG + Intronic
1020118075 7:5487493-5487515 GGACTGTGCAGGGCCATCCAGGG - Intronic
1020434746 7:8150870-8150892 AAGCAGTGCATGGCCCTGCTGGG + Intronic
1020609981 7:10383737-10383759 GGGCTGGGCAGAGCCCACCTTGG + Intergenic
1021518563 7:21515173-21515195 GAGATTTGCAGGGCTCTCCCAGG - Intergenic
1022358359 7:29637299-29637321 GAGCTGCGCATAACCCTCCTTGG + Intergenic
1022771018 7:33473026-33473048 GAGCTCGGCAGGGCCATCCAGGG - Intronic
1024354787 7:48403350-48403372 GAGGGATGCAGGGCCCTCCCTGG + Intronic
1024698562 7:51882458-51882480 CAGCTCTGCAAGCCCCTCCTGGG + Intergenic
1026984821 7:74548066-74548088 GTGCTGTCCCGGGCCCTCATTGG - Intronic
1029109813 7:98207247-98207269 GACCCGTGCAGGGGCCGCCTGGG + Exonic
1029195778 7:98804402-98804424 GAGCTGTGGAGGCCACCCCTGGG + Intergenic
1029272618 7:99385925-99385947 CAGCTGACCAGGGGCCTCCTGGG + Intronic
1029449719 7:100633993-100634015 CCGCAGTGCAGGGCCCTCCGCGG + Intronic
1029883354 7:103840090-103840112 AAGCTGTGCAGGCTTCTCCTGGG - Intronic
1030025719 7:105322811-105322833 GAGCTGTGGAGAGCATTCCTTGG - Intronic
1032721924 7:134556976-134556998 GAGCTGTGCATAAACCTCCTTGG - Intronic
1035024973 7:155819291-155819313 GGGCTGTGCAGGGCACCTCTGGG + Intergenic
1035682830 8:1500963-1500985 GGGCGATGCAGGGCCCTCATGGG + Intergenic
1036177830 8:6556040-6556062 GACGAGTGCAGGGCACTCCTAGG - Intronic
1036427226 8:8655750-8655772 GAGCTTCTCAGGGCCCACCTTGG - Intergenic
1037834614 8:22208724-22208746 GAGCTTTGCAGTCTCCTCCTGGG + Intronic
1039605590 8:38877664-38877686 GAAGTGGGCAGGGCCCTTCTGGG - Intergenic
1039842727 8:41305339-41305361 GAGAAGTGCAGAGCCCTCCTTGG - Intronic
1040031858 8:42832156-42832178 GAGCTAAGAAGGGCCCTCCTGGG - Intergenic
1040386790 8:46919620-46919642 CTGGTGTGCAGGGTCCTCCTGGG - Intergenic
1041135209 8:54750767-54750789 GAGTTGTGCAGGGCACTGATTGG - Intergenic
1041224764 8:55687270-55687292 GAGCTGGGCTGGACCCTTCTAGG - Intergenic
1045866645 8:106873848-106873870 GAGCTGTGCATGGTGCTACTGGG + Intergenic
1048186914 8:132249994-132250016 GGGCTGTGCAGTGCACTCGTGGG - Intronic
1048242921 8:132762010-132762032 GAGCTGGGCAGGGCTAGCCTGGG - Intergenic
1049204682 8:141358262-141358284 GTGCGGTGCAGGGCTGTCCTCGG + Intronic
1049408392 8:142461704-142461726 GAGCTGTGCGGGTCCCTCTGGGG + Intronic
1049800706 8:144516294-144516316 GACCTGTGCGGGGCTCTCCCAGG + Exonic
1053169010 9:35865088-35865110 CACCTCAGCAGGGCCCTCCTGGG - Intergenic
1053303665 9:36969227-36969249 GAGCTGGGCACTGCCCTGCTGGG - Intronic
1054903913 9:70397940-70397962 GAGGTGTGCAGGCCATTCCTGGG + Intronic
1055641903 9:78325400-78325422 GGGCTGTGGAGTGCCCTGCTGGG - Intronic
1056381076 9:86057744-86057766 CAGCCAAGCAGGGCCCTCCTGGG + Intronic
1056554397 9:87676789-87676811 GCACTGTGAGGGGCCCTCCTTGG + Intronic
1056796965 9:89665219-89665241 GTGCTGGGCAGGGCCCTCCCAGG - Intergenic
1056824771 9:89869216-89869238 GATCTTTGGAGGGCCCTTCTTGG + Intergenic
1057036693 9:91816627-91816649 GTGGTATGCAGGGCCCTCCCTGG + Intronic
1057309701 9:93934196-93934218 AAGCAGTTCAGGGACCTCCTGGG + Intergenic
1060743849 9:126117061-126117083 CAGCTGCTCCGGGCCCTCCTGGG + Intergenic
1061933414 9:133844890-133844912 GAGCTGTCTGGGGCCCTCATGGG - Intronic
1062158964 9:135069388-135069410 GAGTTGGGCTGGGCCTTCCTCGG + Intergenic
1062248899 9:135584338-135584360 GAGCAGAGAAGGGCTCTCCTGGG - Intergenic
1062358765 9:136177699-136177721 GAACTCGGCAGGGGCCTCCTGGG + Intergenic
1062479595 9:136745141-136745163 GTGCTGTGCGGGGCCCACGTAGG - Intronic
1189706873 X:43767601-43767623 GGGCTGTGCAGGGACATCCTAGG + Exonic
1191841710 X:65518000-65518022 GAGCTTTGCAGGGCTCTGCATGG - Exonic
1192560512 X:72124984-72125006 GAGATGGGCAGGGCCCACCTGGG - Intergenic
1198487862 X:137106410-137106432 CAGCTGCGAAGGGCCATCCTGGG + Intergenic
1198828257 X:140721253-140721275 GAGTTTTGCAGGGCCATTCTGGG - Intergenic
1199600159 X:149536938-149536960 GAGCTCTGCAGGGGGCTCCCTGG + Intergenic
1199650424 X:149943002-149943024 GAGCTCTGCAGGGGGCTCCCTGG - Intergenic
1202242443 Y:22785615-22785637 GGGCTGTGCATGACACTCCTGGG + Intergenic
1202395428 Y:24419364-24419386 GGACTGTGCATGGCACTCCTGGG + Intergenic
1202475356 Y:25250728-25250750 GGGCTGTGCATGGCACTCCTGGG - Intergenic