ID: 1069910851

View in Genome Browser
Species Human (GRCh38)
Location 10:71758312-71758334
Sequence CTGGAGATACAAAGGCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 253}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069910851_1069910861 4 Left 1069910851 10:71758312-71758334 CCTGGATGCCTTTGTATCTCCAG 0: 1
1: 0
2: 1
3: 19
4: 253
Right 1069910861 10:71758339-71758361 TAGCAGGGGCTGGTCCCCACTGG No data
1069910851_1069910865 22 Left 1069910851 10:71758312-71758334 CCTGGATGCCTTTGTATCTCCAG 0: 1
1: 0
2: 1
3: 19
4: 253
Right 1069910865 10:71758357-71758379 ACTGGATGTCTGACACATACAGG No data
1069910851_1069910858 -6 Left 1069910851 10:71758312-71758334 CCTGGATGCCTTTGTATCTCCAG 0: 1
1: 0
2: 1
3: 19
4: 253
Right 1069910858 10:71758329-71758351 CTCCAGGGCCTAGCAGGGGCTGG No data
1069910851_1069910857 -10 Left 1069910851 10:71758312-71758334 CCTGGATGCCTTTGTATCTCCAG 0: 1
1: 0
2: 1
3: 19
4: 253
Right 1069910857 10:71758325-71758347 GTATCTCCAGGGCCTAGCAGGGG No data
1069910851_1069910866 23 Left 1069910851 10:71758312-71758334 CCTGGATGCCTTTGTATCTCCAG 0: 1
1: 0
2: 1
3: 19
4: 253
Right 1069910866 10:71758358-71758380 CTGGATGTCTGACACATACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069910851 Original CRISPR CTGGAGATACAAAGGCATCC AGG (reversed) Intronic
900584368 1:3425406-3425428 CTGCAGAGCCAAAGGCATCCTGG - Intronic
902240211 1:15083389-15083411 CTGGAGTGACACAGGCAGCCTGG - Intronic
903782555 1:25830754-25830776 CAGGAGACAAAAAGGGATCCAGG - Intronic
904802782 1:33107121-33107143 CTAGAGATACAAAATTATCCAGG + Intronic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
907524338 1:55045490-55045512 CTGGGGATACGAAGGCATCCAGG + Intronic
909119069 1:71577471-71577493 CAGGAGATACATAGTCATCTGGG - Intronic
909673183 1:78211675-78211697 CAGGAGACAGAAAGGCATTCAGG - Intergenic
910361603 1:86417944-86417966 CTGGAGAGGCTAAAGCATCCAGG - Intergenic
910930173 1:92436039-92436061 CTGGTGATACCAAGGCAAACAGG - Intergenic
912301302 1:108520045-108520067 CTGGTGATACAGAGGCAAACAGG - Intergenic
913021343 1:114791627-114791649 CTGGTGATACACAGGCAAACAGG - Intergenic
916372425 1:164114094-164114116 AGGGAGATAGAAAGGCATTCTGG - Intergenic
916749834 1:167714075-167714097 ATGGAGATACAATGGCACCTAGG + Intergenic
918054145 1:181004269-181004291 CTGGAGATTCCAAGGGATCAAGG - Intronic
919603244 1:199648179-199648201 CTGGTGATACCAAGGCAAACAGG + Intergenic
920848104 1:209610429-209610451 CTGGAAAGACAAAGGAATCCAGG - Intronic
920977761 1:210801657-210801679 CCAGACTTACAAAGGCATCCTGG + Intronic
920993081 1:210959217-210959239 CTGGTGATACTCAGGCATACAGG - Intronic
921132849 1:212234543-212234565 CAGGAGAAAGCAAGGCATCCAGG + Intergenic
921481660 1:215671165-215671187 CTGGAGGTACAAATGGCTCCAGG - Exonic
921976428 1:221207736-221207758 CTGGTGATACACAGGCAAACAGG + Intergenic
924178224 1:241414362-241414384 TTGGAAATACCAAGACATCCAGG + Intergenic
1066659026 10:37721362-37721384 CTGCAGCTGCAGAGGCATCCTGG + Intergenic
1067003115 10:42636329-42636351 CTGAAGACACAAAGACTTCCTGG - Intronic
1068042065 10:51837660-51837682 CTGGAGAGACAAATGCATGTAGG - Intronic
1069910851 10:71758312-71758334 CTGGAGATACAAAGGCATCCAGG - Intronic
1070613872 10:77953889-77953911 CTCGAGATAATAAGGAATCCAGG - Intergenic
1073028593 10:100506982-100507004 AAGGAGATACAAAGGCACCATGG + Intronic
1074539332 10:114351654-114351676 CAGGAGAAACGAAGGCCTCCTGG + Intronic
1074721001 10:116265168-116265190 CTGGAGATCCTAAGGCTTCCCGG + Intronic
1075147454 10:119894228-119894250 CTGGAGATAAAAAGGCAATTAGG - Intronic
1075670834 10:124263112-124263134 CTGGAGAGACACAGGCAGGCAGG - Intergenic
1076194984 10:128511346-128511368 ATGGAGATTCAGAGGCCTCCAGG + Intergenic
1076879378 10:133232312-133232334 CCGGAGATACAAATGTAGCCTGG + Intergenic
1078863209 11:15272417-15272439 CCGGAGATGAAAAAGCATCCAGG - Intergenic
1079362709 11:19782627-19782649 CTGGAAAGACAATGGCAGCCTGG - Intronic
1080321915 11:31019886-31019908 CTGGTGATACAAAGACAGACTGG - Intronic
1082204134 11:49411032-49411054 ATGAAGATACAAAGGGATCATGG + Intergenic
1085882177 11:80480522-80480544 ATGGAAAAAAAAAGGCATCCAGG - Intergenic
1086650957 11:89289498-89289520 ATGAAGATAGAAAGGCATCATGG - Intronic
1087004771 11:93458891-93458913 CTGGTGATACAAAGGCAAACAGG + Intergenic
1090116257 11:123977427-123977449 CTGTAGACAAACAGGCATCCAGG + Exonic
1090147378 11:124339978-124340000 CTGGAAAGACAAAGGGATACGGG + Intergenic
1091274780 11:134342731-134342753 CTGGAAAGACAAAGACATTCTGG - Intronic
1093666842 12:21824569-21824591 CTGGAGGTACAAAGAGATGCTGG - Intronic
1093788467 12:23219101-23219123 CTGGAGAAACTGAGGCATTCTGG + Intergenic
1095266578 12:40166148-40166170 CTGGAGATAAAAATTCTTCCTGG - Intergenic
1096147604 12:49290023-49290045 CTGGGAAGACAAAGGAATCCTGG + Intergenic
1096803958 12:54128890-54128912 CTGGAGACAGAAAGGTATTCTGG + Intergenic
1097139544 12:56888718-56888740 CTGGTGATACACAGGCAAACAGG + Intergenic
1097353442 12:58574651-58574673 ATGGTAATACAAAGACATCCTGG + Intronic
1097803378 12:63939502-63939524 GAGGAGAAAAAAAGGCATCCAGG + Intronic
1098441859 12:70527705-70527727 TTTGAGATACAAAGGGATGCAGG - Intronic
1098571355 12:71991160-71991182 CTAGAGATCCAAAGACATTCAGG - Intronic
1100084397 12:90891143-90891165 CTGGAGTTCCAAGGTCATCCGGG - Intergenic
1102778335 12:115540785-115540807 GTGGAGATATAAAGGGATCTTGG - Intergenic
1106088384 13:26563063-26563085 CTGGAGACACAATGGCACCTAGG - Intronic
1106772019 13:32970939-32970961 CTGGGTATGCAAAGGCATACAGG - Intergenic
1106946522 13:34833640-34833662 CTACAGCTACAAAGGCATCAGGG - Intergenic
1108394009 13:49975422-49975444 CAGGAAATATAAAGGCAACCTGG - Intergenic
1108797093 13:54044667-54044689 CTGGTGATACACAGGCAAACAGG + Intergenic
1109156871 13:58922179-58922201 CTGGAGATGAAAAGGCATTAGGG - Intergenic
1110380685 13:74847053-74847075 CTGGAAATTCAAGAGCATCCTGG + Intergenic
1115452139 14:33560123-33560145 GTGCAAATACAAAGCCATCCAGG - Exonic
1115721000 14:36161524-36161546 CTGGAGATACCCAGGCAACAGGG - Intergenic
1116595710 14:46841757-46841779 CTGGGGATAAAAAGACATCATGG - Exonic
1117489250 14:56229459-56229481 CTGGTGATACCAAGGCAAACGGG + Intronic
1117892719 14:60443884-60443906 CTGGTGATACACAGGCAAACAGG + Intronic
1118047948 14:61992714-61992736 TTGGAAATTCAAATGCATCCAGG + Intergenic
1118108571 14:62689951-62689973 CTGGAGAAACAAGGGTATCCAGG + Intergenic
1118718421 14:68576554-68576576 ATGGAGATGCTAAAGCATCCAGG + Intronic
1119093502 14:71806911-71806933 CTGGTGATACACAGGCAAACAGG - Intergenic
1119134916 14:72208581-72208603 CTGGAGATACAAAGGGAAATAGG - Intronic
1120619834 14:86750278-86750300 CTGGTGATACACAGGCAAACAGG - Intergenic
1120928895 14:89827434-89827456 CCGGAGATACAGAGGCTACCGGG - Intronic
1120997593 14:90428180-90428202 CTGGTGAGACAGAAGCATCCGGG - Intergenic
1121058922 14:90885340-90885362 CAGGAGATCGAGAGGCATCCTGG + Intronic
1122210427 14:100170313-100170335 CAGGAGAAACAAAGGGCTCCCGG + Intergenic
1122364740 14:101187948-101187970 CAGGAGATACAAACCCATCCTGG + Intergenic
1127614141 15:60666713-60666735 CTACAGATACAAAGGCACCGAGG + Intronic
1128545789 15:68566710-68566732 TTGGAGACAAAAAGTCATCCTGG + Intergenic
1129090920 15:73149429-73149451 CTGGAGATACAATGACATATAGG + Intronic
1129217185 15:74107131-74107153 CTGAGAATCCAAAGGCATCCAGG + Intronic
1129495488 15:75976631-75976653 CTGGTGATACACAGGCAAACGGG - Intronic
1130699214 15:86162283-86162305 CTGCTCCTACAAAGGCATCCCGG - Intronic
1130902987 15:88220893-88220915 CTGGAGGTTCAGAGGCATCCAGG - Intronic
1131307693 15:91259761-91259783 ATGGAGACACAGAGGCATCAGGG - Intronic
1131556912 15:93407664-93407686 GTGAGGATACAAAGGCATCCTGG + Intergenic
1134436759 16:14266538-14266560 CAGCAAATACAAAGGCATCATGG - Exonic
1135952870 16:26931576-26931598 CTGATCATACAAAGGCTTCCTGG + Intergenic
1138445336 16:57059683-57059705 CTGGAGTTACCAGGGCATCGGGG - Intronic
1140862477 16:79030433-79030455 GTGCAGATCAAAAGGCATCCTGG - Intronic
1142669494 17:1481257-1481279 TTGGAGAAACACAGGCTTCCAGG - Intronic
1143654668 17:8287052-8287074 CTGGAGATACAAAGACATTTAGG - Intergenic
1146530660 17:33605054-33605076 CTGGAGATTCAAAGTCTACCTGG - Intronic
1149794354 17:59505718-59505740 CTGAAGATTCAGAGGAATCCAGG + Intergenic
1152637406 17:81435763-81435785 CCGGGGACACACAGGCATCCTGG - Intronic
1152637429 17:81435835-81435857 CCGGGGACACACAGGCATCCTGG - Intronic
1153687978 18:7566151-7566173 CCGGTGATACAGAGGCACCCAGG - Intergenic
1153879568 18:9408621-9408643 CTGGACATACAACGTCATTCTGG - Intergenic
1155747720 18:29381252-29381274 CTGGATTCCCAAAGGCATCCTGG + Intergenic
1155999397 18:32368074-32368096 CTGGGCCTAAAAAGGCATCCTGG - Intronic
1156918565 18:42490576-42490598 CAGGAGGTAGAAAGGCATCATGG - Intergenic
1159522118 18:69539568-69539590 CAGGAGATACATATGTATCCTGG + Intronic
1159968233 18:74617907-74617929 CTGGAGATAGAAAAGCATACTGG - Intronic
1160277738 18:77453494-77453516 CTGGAGAAACAATGGCACCAAGG - Intergenic
1162333441 19:10045114-10045136 CTGGAGACAAAAAGGAATGCAGG + Intergenic
1163424006 19:17231008-17231030 CTGGGGCTCCAAAGGCATCTTGG + Intergenic
1164697381 19:30255979-30256001 CTGCAGATGCAGAGGCCTCCTGG - Intronic
1165761556 19:38324499-38324521 CTGGAGCTACACAGCCATCTTGG - Intronic
1165762423 19:38329501-38329523 CTGGAGATGGAAAAGCATGCTGG + Intergenic
1168053777 19:53849398-53849420 CTGGAGATCCTAAGGAAGCCTGG - Intergenic
925736311 2:6967119-6967141 CTGGAGAAGCAAAGGCTTGCTGG - Intronic
930775546 2:55166750-55166772 CTGAAGATACAAAGGGATCAAGG + Intergenic
932476633 2:72010713-72010735 GTGGAGGTGCACAGGCATCCCGG + Intergenic
933217018 2:79642721-79642743 CTAGAGAGTAAAAGGCATCCTGG - Intronic
935083424 2:99821902-99821924 ATGAAGAAACAAAGGCAGCCAGG + Intronic
936769439 2:115894401-115894423 CTGGTGATACACAGGCAAACAGG - Intergenic
937384838 2:121419685-121419707 ATGGAGAAACAAGGGTATCCTGG - Intronic
937826529 2:126373209-126373231 CTAGAGAGCCAAAAGCATCCGGG + Intergenic
937993554 2:127677108-127677130 CTGGAGATGCAGAGGCTTCAAGG + Intronic
942202590 2:173586544-173586566 CTAAAAATACAAAGTCATCCAGG + Intergenic
942753644 2:179315344-179315366 CTGGTGATACACAGGCAAACAGG + Intergenic
945422804 2:209660160-209660182 ATGGGGAGACAAAGGAATCCTGG - Intronic
945764624 2:213959685-213959707 CTGGAATTCCAAAGGCATCAGGG - Intronic
945776620 2:214114128-214114150 CTGGTGATACACAGGCAAACAGG - Intronic
946017341 2:216614619-216614641 CTGGAGAAATACAGGCAGCCTGG - Intergenic
946300079 2:218817749-218817771 GTGGATATACAAAGTCTTCCTGG - Intergenic
946611696 2:221465571-221465593 CCGTAGATACAAAGGAATCTAGG - Intronic
947946307 2:234105939-234105961 CTGAAGATGAGAAGGCATCCAGG - Intergenic
948228547 2:236332885-236332907 CTGTGGATGCATAGGCATCCAGG + Intronic
1170212075 20:13855681-13855703 CAGGAGATACAAAGGCTTTAGGG - Intronic
1171000949 20:21414674-21414696 CTGGTGATACACAGGCAAACAGG + Intergenic
1172621769 20:36322101-36322123 CTGGAGTCACAAAGGCTTCCTGG + Intronic
1174657898 20:52186970-52186992 TGTGAGCTACAAAGGCATCCAGG + Exonic
1175367980 20:58468353-58468375 CTGGTGATACAAACAGATCCAGG + Intronic
1176035542 20:63034738-63034760 CTGGAGACGCTAAAGCATCCAGG + Intergenic
1176338830 21:5623925-5623947 CTGGAGAGAGAAAGACAGCCTGG - Intergenic
1176340238 21:5686998-5687020 CTGGAGAGAGAAAGACAGCCTGG - Intergenic
1176472492 21:7119151-7119173 CTGGAGAGAGAAAGACAGCCTGG - Intergenic
1176504589 21:7637458-7637480 CTGGAGAGAGAAAGACAGCCTGG + Intergenic
1176639264 21:9283158-9283180 CTGGAGATAGAAAAACATACAGG + Intergenic
1180372567 22:12055989-12056011 CTGGAGATAGAAAAACATACAGG + Intergenic
1180423309 22:12890647-12890669 CTGGAGATAGAAAAACATACAGG + Intergenic
1183028470 22:35084233-35084255 CTCCAGATCCAAAGACATCCTGG + Intronic
1184144310 22:42599882-42599904 CTGGAGAAACAAAGGGACCAAGG + Intronic
1184872684 22:47251061-47251083 CTGGAGCTACAGGGGCCTCCGGG - Intergenic
1203239504 22_KI270733v1_random:1456-1478 CTGGAGAGAGAAAGACAGCCTGG - Intergenic
949944747 3:9180978-9181000 CTGGAGACACGGAGGCAGCCGGG + Intronic
950992127 3:17450070-17450092 CTGGTGATACCAAGGCAAACAGG + Intronic
952501774 3:33969963-33969985 CTGGAGATACCCAGGCAAACAGG - Intergenic
954836431 3:53473242-53473264 CTGGTGATACCCAGGCATGCAGG - Intergenic
955392310 3:58530682-58530704 CTGGAGAAGCGAGGGCATCCTGG - Intronic
955630226 3:60965712-60965734 CTGGTGATACACAGGCAAACAGG - Intronic
957249760 3:77757584-77757606 CTGGTGATACCAAGGCAAACAGG + Intergenic
957771513 3:84698649-84698671 CTGGTAATAAAAAGGAATCCAGG + Intergenic
958261168 3:91383056-91383078 CTGGTGATACACAGGCAAACAGG - Intergenic
959097337 3:101970706-101970728 CTGGTGATACACAGGCAAACAGG - Intergenic
960653998 3:119982054-119982076 CTGGTGATACACAGGCAACCAGG + Intronic
960787620 3:121391687-121391709 CTGGTGATACCAAGGCAAACAGG - Intronic
966356550 3:179085693-179085715 CTGGATTTACCAATGCATCCAGG + Intergenic
967315308 3:188146989-188147011 CTGAAGATTCACAGGCTTCCAGG + Intergenic
1202747631 3_GL000221v1_random:121869-121891 CTGGAGATAGAAAAACATACAGG - Intergenic
968933045 4:3593428-3593450 CTGGAGAAAAACAGGCTTCCGGG - Intergenic
969563645 4:7965024-7965046 CTGGGGAGACAAGGGCAGCCAGG - Intergenic
971046478 4:22810838-22810860 CTGGAGAAAGAAAGCCTTCCGGG - Intergenic
971326954 4:25652489-25652511 GTGGTGAGACAAAGGCACCCAGG - Intergenic
971571749 4:28221128-28221150 CTGGAGATACCAAGTCTTTCAGG + Intergenic
971673517 4:29595000-29595022 CTGGTGATACCCAGGCAACCAGG - Intergenic
972038959 4:34566085-34566107 ATGGAGATAAAAAGGGATTCCGG - Intergenic
972865274 4:43224850-43224872 CTGGAGATACAAAGAAAAACTGG + Intergenic
973093099 4:46162963-46162985 CTGGGGAGACAAAGGCATGACGG + Intergenic
974719962 4:65725516-65725538 CTGGTGATACCAAGGCAAACAGG + Intergenic
976061161 4:81130291-81130313 CTGGTAATACAAAGGCATACGGG - Intronic
977723389 4:100267075-100267097 CTGGTGATACCAAGGCAAACAGG - Intergenic
977813996 4:101392227-101392249 ATGGATATGCAAAGGCATGCAGG + Intergenic
977979943 4:103309568-103309590 CTGGGAATACAAAGGCAGTCGGG + Intergenic
978055004 4:104252779-104252801 CTGGTGATACACAGGCAAACAGG + Intergenic
979581461 4:122365662-122365684 CTGGTGATACACAGGCAAACAGG + Intergenic
979588651 4:122450987-122451009 CTTGAGAGACACAGCCATCCTGG + Intergenic
980790988 4:137619360-137619382 CTAGAGATAAAAAGAAATCCAGG + Intergenic
981322751 4:143411585-143411607 CTGGAGCTACCAAGGCAGCAAGG + Intronic
981662606 4:147184721-147184743 CTGGTGATACACAGGCAAACTGG + Intergenic
983596225 4:169471426-169471448 CTGGAGATACCCAGGCAAACAGG - Intronic
984493764 4:180469225-180469247 CTGGTGATACACAGGCAAACAGG + Intergenic
984511285 4:180681982-180682004 CTGAAGACACAATGGCCTCCTGG + Intergenic
1202754156 4_GL000008v2_random:41550-41572 CTGGAGATAGAAAAACATACAGG + Intergenic
986854920 5:11857327-11857349 GTGGCGATACAAAGGCACCGAGG + Intronic
989334696 5:40302046-40302068 CTGGAGATACCCAGGCAAACAGG - Intergenic
989459841 5:41684539-41684561 GTGGAGTTACAAAGTGATCCTGG + Intergenic
991712323 5:69419850-69419872 CTAGAGATCCATAGGGATCCCGG - Exonic
992873571 5:81029515-81029537 CTGGTGATACACAGGCAAACAGG + Intronic
993052807 5:82944897-82944919 CTGGTGATACCCAGGCATACAGG + Intergenic
993609106 5:90032349-90032371 CTGGTGATACACAGGCAAACAGG + Intergenic
995302001 5:110595111-110595133 CTGGTGATACCCAGGCATACAGG + Intronic
995469107 5:112481239-112481261 TTGGAGACACTATGGCATCCAGG - Intergenic
995956863 5:117787510-117787532 CTTGAGTGACAAAGCCATCCTGG - Intergenic
996626764 5:125579638-125579660 CTGAAGATACAAAGGCAATGAGG + Intergenic
996827563 5:127702772-127702794 CTGGGTCTACAAATGCATCCAGG + Intergenic
996953207 5:129152779-129152801 CTGGAGATACACAGGCAAACAGG - Intergenic
998400851 5:141848437-141848459 GTGGAGATACACAGGCAGACAGG - Intergenic
998644693 5:144048919-144048941 CTGGTGATACCAAGGCAAACAGG + Intergenic
999248996 5:150170621-150170643 GTGGAGAGACAGAGGCAGCCAGG - Intronic
1001763643 5:174227403-174227425 ATGGAGAGAAAAAGTCATCCTGG + Intronic
1003987628 6:11452643-11452665 CTGGTGATACCCAGGCAACCAGG + Intergenic
1004056132 6:12140199-12140221 CTGGTGATACCCAGGCATACAGG + Intronic
1008993996 6:57637094-57637116 CTGGTGATACACAGGCAGACAGG + Intronic
1009182601 6:60536184-60536206 CTGGTGATACACAGGCAAACAGG + Intergenic
1010569898 6:77463816-77463838 CTGCAGATCCAAAAGCGTCCAGG - Intergenic
1010778771 6:79918699-79918721 CTGGAAATTCAAAGCCAACCTGG - Intronic
1014176941 6:118341844-118341866 CTGGTGATACACAGGCAAACAGG - Intergenic
1015612592 6:135040800-135040822 CTAGAGATACAAAGGGTTCTAGG - Intronic
1016333812 6:142982677-142982699 CTGGTGATACCAAGGCAAACAGG - Intergenic
1020036264 7:4964945-4964967 CAGGTGAGAAAAAGGCATCCAGG + Intergenic
1022090767 7:27106704-27106726 CGGAAGAAACAAAGACATCCCGG - Exonic
1022187353 7:27982808-27982830 CTGGTGATACACAGGCAAACAGG + Intronic
1024477566 7:49829751-49829773 CTGAAGATGCAAAGAGATCCAGG - Intronic
1026010182 7:66629678-66629700 CTGGAAAAACAAAGGCATTTTGG + Intronic
1027554535 7:79647519-79647541 CTGGAGATAAGAAGACATCCTGG + Intergenic
1028002273 7:85514204-85514226 CTGGAGAAACAAATTCATCCAGG - Intergenic
1028985140 7:97003606-97003628 CTGGAGATAGCTAGACATCCAGG + Intergenic
1033281147 7:140007307-140007329 ATGGGGATACAAAGGAACCCAGG - Intronic
1034332255 7:150293010-150293032 CTGAAGATCCAGAGACATCCTGG + Intronic
1034665781 7:152816867-152816889 CTGAAGATCCAGAGACATCCTGG - Intronic
1036049535 8:5180451-5180473 CTTGAGAGACAAATGCAACCGGG - Intergenic
1037033374 8:14137011-14137033 CTGGTGATACCAAGGCAAACAGG + Intronic
1039925667 8:41929618-41929640 GGAGAGATACAAAGGCATCTAGG + Exonic
1041155157 8:54977726-54977748 CTGGTGATACCAAGGCAAACAGG + Intergenic
1042111027 8:65380784-65380806 CTGGTGATACATAGGCAGACAGG + Intergenic
1045370219 8:101515465-101515487 CAGGAGAGACATAGGCTTCCTGG - Intronic
1046358631 8:113121149-113121171 CTGGAGATAAAGAAGCATGCAGG + Intronic
1047018586 8:120750220-120750242 CTGGAGATACAAAGGTTTAAGGG - Intronic
1048888839 8:138930685-138930707 CTTCAGCTCCAAAGGCATCCTGG - Intergenic
1048914011 8:139164976-139164998 CTGGTGATACCAAGGCAAACAGG - Intergenic
1051564596 9:18483139-18483161 CTAGAGATACAAAGATATTCAGG - Intronic
1051691082 9:19712932-19712954 CTGGAGAGGCAAAGTCACCCTGG + Intronic
1052770567 9:32684974-32684996 CTGGTGATACCAAGGCAAACAGG + Intergenic
1053313838 9:37035855-37035877 CTGGAGATCAAAAGCCCTCCCGG + Intergenic
1054457084 9:65438549-65438571 CTGGAGAAAAACAGGCTTCCGGG + Intergenic
1054760180 9:68997881-68997903 CTGGAGTTATAAAGGCACACTGG + Intronic
1055769807 9:79704934-79704956 CTGCAGATAAAAAGGCAAGCTGG - Intronic
1056797818 9:89670654-89670676 CTGGAGAGACAGAGGCACCTAGG + Intergenic
1056997073 9:91473008-91473030 CTGGTGATACACAGGCAAACAGG - Intergenic
1058677125 9:107409922-107409944 TTGGGGACACAAAGGCTTCCAGG - Intergenic
1059216342 9:112567422-112567444 CTGGAACTACAGAGGCCTCCTGG - Intronic
1059987666 9:119835887-119835909 CTGGGGATACTGAGGCACCCAGG - Intergenic
1060983874 9:127808803-127808825 CTGGGGAGCCAAAGGCATCCAGG + Exonic
1203422829 Un_GL000195v1:10995-11017 CTGGAGAGAGAAAGACAGCCTGG + Intergenic
1203692787 Un_GL000214v1:61217-61239 CTGCAGATATAAACGCCTCCTGG - Intergenic
1203716267 Un_KI270742v1:151960-151982 CTGGAGATAGAAAAACATACAGG - Intergenic
1203534947 Un_KI270743v1:26275-26297 CTGGAGATAGAAAAACATACAGG + Intergenic
1203556972 Un_KI270744v1:8109-8131 CTGCAGATATAAACGCCTCCTGG - Intergenic
1203643508 Un_KI270751v1:42974-42996 CTGCAGATATAAACGCCTCCTGG + Intergenic
1203650499 Un_KI270751v1:115529-115551 GTGGAGATAGAAAAGCATACAGG - Intergenic
1187722804 X:22169639-22169661 CTGGAGGAACAGAGGCATCAGGG + Intronic
1188816247 X:34718368-34718390 ATGGTGATAGAAAGGCATCATGG - Intergenic
1189080627 X:37968374-37968396 CTGGGGGTAAAAAGGCTTCCTGG - Intronic
1191175144 X:57491425-57491447 TTGGTGATACAAAGGCAACCAGG + Intergenic
1191657545 X:63614308-63614330 CTGGAGATACCCAGGCAAACAGG + Intergenic
1191931272 X:66375944-66375966 CTGGAGATACCCAGGCAAACAGG - Intergenic
1193228338 X:79012697-79012719 CTGGTGATACACAGGCAGACAGG - Intergenic
1193806635 X:86003097-86003119 CTGGTGATACCCAGGCATACAGG + Intronic
1193968453 X:88019952-88019974 CTGGAGAGACAAGTGAATCCAGG + Intergenic
1194021348 X:88695354-88695376 CTGGTGATACCCAGGCATACAGG + Intergenic
1195671421 X:107473372-107473394 CTGCAAATACAAGTGCATCCAGG - Intergenic
1195846045 X:109229618-109229640 CTGGTGATACCAAGGCAAACAGG + Intergenic
1195847880 X:109248315-109248337 CTGGTGATACCAAGGCAAACAGG - Intergenic
1195938037 X:110143770-110143792 CAGGACAGACAAAGGCACCCAGG - Intronic
1198295297 X:135281791-135281813 CTGGTGATACACAGGCAAACAGG - Intronic
1201490971 Y:14540663-14540685 CTGGTGATACCAAGGCAAACAGG + Intronic
1202253889 Y:22901276-22901298 CTGGTGATACCAAGGCAAACAGG - Intergenic
1202406879 Y:24535025-24535047 CTGGTGATACCAAGGCAAACAGG - Intergenic
1202463902 Y:25135056-25135078 CTGGTGATACCAAGGCAAACAGG + Intergenic