ID: 1069911322

View in Genome Browser
Species Human (GRCh38)
Location 10:71761607-71761629
Sequence CCATGGTGCCATGGAGCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 235}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069911322_1069911326 -5 Left 1069911322 10:71761607-71761629 CCTGCAGCTCCATGGCACCATGG 0: 1
1: 0
2: 2
3: 25
4: 235
Right 1069911326 10:71761625-71761647 CATGGACCCTGTGCTCCGAGTGG 0: 1
1: 0
2: 1
3: 12
4: 118
1069911322_1069911331 19 Left 1069911322 10:71761607-71761629 CCTGCAGCTCCATGGCACCATGG 0: 1
1: 0
2: 2
3: 25
4: 235
Right 1069911331 10:71761649-71761671 GGTGCCTGATCTCCACCACCAGG 0: 1
1: 0
2: 0
3: 16
4: 151
1069911322_1069911327 -2 Left 1069911322 10:71761607-71761629 CCTGCAGCTCCATGGCACCATGG 0: 1
1: 0
2: 2
3: 25
4: 235
Right 1069911327 10:71761628-71761650 GGACCCTGTGCTCCGAGTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069911322 Original CRISPR CCATGGTGCCATGGAGCTGC AGG (reversed) Exonic
900477406 1:2882426-2882448 CCCTGGTGCTATGGAGAAGCTGG - Intergenic
900928379 1:5720148-5720170 CCCTGATGCCATGGAGGTGCAGG + Intergenic
901325697 1:8364026-8364048 CCCTGGGGCCATGGGGCTCCTGG - Intronic
901479904 1:9518098-9518120 GCATGGTGCCATGCACCTGTAGG + Intergenic
901498289 1:9635448-9635470 ACATGGAGCCAGCGAGCTGCAGG - Intergenic
902690588 1:18108110-18108132 GCATGGTGCCCGGGAGCTGGCGG - Exonic
902804984 1:18855427-18855449 CCATGGAGCCCTGGAGGTGGAGG - Intronic
903661216 1:24980021-24980043 CCTTGGTGACAGGGGGCTGCAGG - Intergenic
903886861 1:26545874-26545896 CCATGGTGCCGTGGCCCTGCTGG + Exonic
904744228 1:32701600-32701622 CCATGGTGCCAGGCCTCTGCTGG + Intronic
905840089 1:41169327-41169349 CCAGGCTGCCAAGTAGCTGCTGG + Intronic
906503735 1:46361654-46361676 GCAAGGTGCCATTGAGCTCCTGG + Exonic
907411273 1:54285385-54285407 CCCTGCTGCCGTTGAGCTGCAGG - Intronic
911773324 1:101775378-101775400 CCATGGTGCCAGACAGATGCTGG + Intergenic
912172944 1:107122570-107122592 GCATTGTGCCATGGAGGTTCAGG + Intergenic
915609424 1:156979271-156979293 CCATGGTGCCGTTGACCTGTTGG + Exonic
916064114 1:161122224-161122246 CCATGAAGCCATCAAGCTGCTGG - Exonic
917035961 1:170747080-170747102 TCATTGTGCCTTGGAGGTGCAGG + Intergenic
917876753 1:179293463-179293485 GCGTGGTAGCATGGAGCTGCAGG - Intergenic
922799991 1:228360764-228360786 CCATGGTGGCTTGGGGCAGCGGG + Intronic
922993779 1:229939903-229939925 CCCTTGTGCCAGGTAGCTGCCGG + Intergenic
924676120 1:246179760-246179782 CCATGTTGGCATTGAGCTCCAGG + Intronic
1062860448 10:805785-805807 CCATGCTGCCTGGGACCTGCTGG - Intergenic
1063300341 10:4844944-4844966 ACCTGGTGCCATGGAGCAGGGGG + Intronic
1063842518 10:10088456-10088478 CAATGGTGCCAGGGAGCTGGAGG + Intergenic
1065958663 10:30715577-30715599 GCATGGTGGCATGCACCTGCAGG + Intergenic
1067558091 10:47286124-47286146 TGATGGTGCCATGGAGCTGAAGG - Intergenic
1069636610 10:69929108-69929130 CCCTGGTGCCTTGGAGCAGCAGG - Intronic
1069911322 10:71761607-71761629 CCATGGTGCCATGGAGCTGCAGG - Exonic
1070695273 10:78558562-78558584 CCAAGGTCCCTTGGAGCTTCAGG - Intergenic
1070774517 10:79101986-79102008 CCCTGGTGCCATGGGGAGGCTGG - Intronic
1070794417 10:79208362-79208384 CAATGCCGCCACGGAGCTGCTGG + Exonic
1070962548 10:80509294-80509316 CGATGGTGCCACAGAACTGCAGG - Exonic
1072724227 10:97801674-97801696 ACAGAGTGCCATGGAGGTGCTGG + Intergenic
1074158435 10:110817812-110817834 CGCTGGAGCCCTGGAGCTGCTGG - Intronic
1074751447 10:116591267-116591289 CTCTGGTACCCTGGAGCTGCTGG - Intronic
1076110747 10:127857246-127857268 CCATGGTGCCTTGCAGATGCTGG + Intergenic
1078101090 11:8330726-8330748 CCATGGTGCCAGAGAGGGGCGGG - Intergenic
1079099412 11:17531535-17531557 CCATGGTCCTGTGGAGATGCCGG + Exonic
1080138883 11:28890939-28890961 ACTGGGTGCCATGGAGCAGCGGG - Intergenic
1080503035 11:32888241-32888263 ACTGGGTGCCATGGAGCAGCGGG + Intergenic
1080722053 11:34859432-34859454 CCATGATACGCTGGAGCTGCAGG + Intronic
1081537658 11:44007139-44007161 CCCTAGGGCCAGGGAGCTGCAGG + Intergenic
1081807704 11:45899485-45899507 CCAAGGTGCCAGGGAGTTGGCGG + Intronic
1082091222 11:48091164-48091186 CCTCTGTGCCTTGGAGCTGCAGG + Intronic
1083482681 11:62959783-62959805 CCAGGGTGACTTGGATCTGCTGG + Intronic
1083486262 11:62984621-62984643 CCAGGGTGACCTGGATCTGCTGG + Exonic
1084638017 11:70405928-70405950 GCATGGTGCCATGGGGCGGCCGG + Intronic
1086509406 11:87540722-87540744 CCATGATGACATGAAGATGCAGG + Intergenic
1086562084 11:88179256-88179278 CCATGGTGCAGTGTGGCTGCTGG - Intergenic
1087925029 11:103910283-103910305 ACATGTTGCCCTGGAGTTGCTGG + Intronic
1088080321 11:105903931-105903953 CCCTGGCCCCATGGAGCAGCAGG - Exonic
1088156668 11:106813577-106813599 CCATGCTCTCATGGAGCTTCAGG + Intronic
1088626281 11:111732794-111732816 CCATGGTGCCCACGGGCTGCTGG - Intronic
1089154990 11:116394959-116394981 CCAGGCTGCCCTGGAACTGCTGG - Intergenic
1089683692 11:120133613-120133635 CCAGGGTGCCCTGGAGGGGCTGG - Intronic
1089786475 11:120910970-120910992 TCATGGGGCCATGAAGGTGCAGG + Intronic
1090844084 11:130516574-130516596 CCAGGGACCCCTGGAGCTGCAGG + Intergenic
1091221296 11:133931385-133931407 CCAGGGAGCCCTGGGGCTGCGGG - Intronic
1092127344 12:6084306-6084328 CCTTGGAGCCAGGGAGATGCTGG - Intronic
1093353540 12:18134068-18134090 CCATGGTGCCATGGAGTTTCTGG - Intronic
1094190070 12:27689146-27689168 GCGAGATGCCATGGAGCTGCCGG + Exonic
1094832270 12:34305797-34305819 GCATGGTGCCTTGGAGATCCTGG + Intergenic
1095960653 12:47832642-47832664 CCAGGGTGCCTGGGAGCTGGAGG - Intronic
1096574013 12:52541381-52541403 CCAAGGTGAGATGGAGATGCTGG - Intergenic
1101971068 12:109312828-109312850 CCAGGGTGCCATGGCCCTGGAGG - Intergenic
1102455250 12:113066871-113066893 CCTTGGAGCCCAGGAGCTGCCGG + Intronic
1103006012 12:117420915-117420937 CCTTGGTGCCATGCAGCCTCTGG + Intronic
1103366579 12:120388753-120388775 CCATGGGGCCAGGCACCTGCTGG - Intergenic
1103973274 12:124685795-124685817 CCAGGGCGCCATGGTGCTCCTGG + Intergenic
1105456326 13:20544491-20544513 CCCTGATGTCCTGGAGCTGCGGG - Intergenic
1105918324 13:24938139-24938161 CCTTGGTGTCTGGGAGCTGCCGG + Intergenic
1106968765 13:35108634-35108656 CTATGTGGCCATTGAGCTGCTGG - Intronic
1107372992 13:39772598-39772620 CCATGGTGCCAGGGAACTTTAGG - Intronic
1112450732 13:99506854-99506876 CCATGGTGACAGGAAGCTACAGG - Intronic
1112517114 13:100063600-100063622 ACATGGTACGGTGGAGCTGCGGG + Intergenic
1112661959 13:101520556-101520578 CCATAGTTCCATGGAGGTGATGG + Intronic
1112926287 13:104679076-104679098 ACAATGTGCCATGGAGCTGTAGG + Intergenic
1113944684 13:114037464-114037486 ACAGAGTGCCATGGGGCTGCCGG + Intronic
1114621507 14:24099019-24099041 CAATGGGGTCATGGGGCTGCTGG - Intronic
1117296852 14:54388156-54388178 ACAAGGTGTCATGGAGCTACAGG + Intergenic
1117742544 14:58833734-58833756 CCATGGTACCCTGGAGGTGGAGG + Intergenic
1118085082 14:62405211-62405233 CCATGATGCCATGGCTCTTCAGG - Intergenic
1118983570 14:70734552-70734574 CCATAGACCCATGGAGCTGAGGG - Intronic
1119460554 14:74798862-74798884 CCATGGTTCCATGGAGCCCTAGG - Exonic
1119615894 14:76099048-76099070 CCAGGAAGCCATGGTGCTGCGGG - Intergenic
1121818175 14:96944126-96944148 AGAAGGGGCCATGGAGCTGCTGG - Intergenic
1122101007 14:99409450-99409472 GCAGGGCTCCATGGAGCTGCTGG - Intronic
1122325270 14:100877922-100877944 ACATGGTGCCCTTGAGCTCCTGG + Intergenic
1122633485 14:103118883-103118905 CCAGGGTCTCATGGAGCTGTAGG + Intergenic
1122799482 14:104222533-104222555 CTATGGTGTCAGGGAGCTTCGGG + Intergenic
1124102995 15:26713000-26713022 CCATGGTGGCATGCTGCTTCTGG - Intronic
1124129487 15:26971517-26971539 CCATGGTGCCGTGGAGCTCGGGG - Exonic
1124621509 15:31276658-31276680 CCATGGGCCCATGGAGATACTGG + Intergenic
1131370283 15:91875354-91875376 ACATCATGCCATGGAGCTGGGGG - Intronic
1132666852 16:1084894-1084916 CCATGGGGGCTTGGAGCTTCAGG + Intergenic
1132986852 16:2771779-2771801 CCATGGTGCCTTTAAGCAGCAGG + Intronic
1133139185 16:3731790-3731812 CCATGGTGGCATACAGCTTCTGG + Exonic
1135507664 16:23052801-23052823 CTAAGGTGCCATGGAGCTAAGGG + Intergenic
1137054406 16:35736380-35736402 CTATGGTGTCTTGGGGCTGCTGG - Intergenic
1137531772 16:49282453-49282475 ACGTGGTGCCCGGGAGCTGCTGG + Intergenic
1138264694 16:55652121-55652143 CATTGGTGCCATGGAGGTGTAGG + Intergenic
1139559090 16:67730328-67730350 ACATGGTGCCAGGGACCTGGGGG + Intronic
1140430290 16:74897234-74897256 CTATGAAGCCATGTAGCTGCAGG - Intronic
1144485602 17:15661742-15661764 CCATGGCGTCATGGAGCTTAAGG - Intronic
1146158892 17:30548410-30548432 CCATGGTGCCAGGGCACTGACGG - Intergenic
1146400072 17:32494977-32494999 CAATGGTGGCCGGGAGCTGCCGG - Intronic
1146621781 17:34404432-34404454 CCATGGAGGCATGGAGGTGTGGG - Intergenic
1147673492 17:42190109-42190131 CCAGGGTGCCATGGAGATCAGGG - Intronic
1147966772 17:44198421-44198443 CCATGGTGCAATGCAGCAGGGGG + Intronic
1148261171 17:46184749-46184771 CCAGGGTGTCATGGGGGTGCAGG - Intronic
1149597835 17:57874609-57874631 GCAGGCTGCCATGGAGCTGTGGG - Intronic
1151480892 17:74369539-74369561 CGATGCTGACAGGGAGCTGCGGG + Exonic
1151620035 17:75239858-75239880 CCATGGTGCCCAGGGACTGCGGG + Exonic
1152205538 17:78972613-78972635 CTATGGGGCCAGGCAGCTGCAGG - Exonic
1152365880 17:79856017-79856039 CCAGGGTGCCATCCAGCTCCTGG + Intergenic
1152519110 17:80845171-80845193 CCTGGGTGCCATGGAGCAGGTGG - Intronic
1152829807 17:82490193-82490215 GCATGGTTCCATGGAGTTTCAGG - Exonic
1153278872 18:3395337-3395359 CCATGGAGGCCTGGAGCTGGAGG + Intergenic
1160345235 18:78127209-78127231 CCTTCGTGCCAGGGAGCGGCCGG - Intergenic
1160553148 18:79708224-79708246 GCATAGTGCCGTGGGGCTGCAGG + Intronic
1161294442 19:3512616-3512638 CCTTGGGTCCCTGGAGCTGCAGG + Intronic
1161353953 19:3808968-3808990 CCACCAGGCCATGGAGCTGCTGG - Exonic
1161436509 19:4266840-4266862 CCATGGTGGCGTGCACCTGCAGG + Intronic
1162445678 19:10721077-10721099 CCATGGTGTCTGGCAGCTGCCGG + Intronic
1163729811 19:18942220-18942242 CCTTGGTTCCAGGGAGCTGCAGG - Intergenic
1164715931 19:30390411-30390433 CCAGGGTGGCAGGCAGCTGCAGG + Intronic
1166077646 19:40423072-40423094 CCTGGGTGCCTTGGACCTGCTGG - Exonic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1166902011 19:46071823-46071845 CCATGTTGCCCAGGAGTTGCTGG - Intronic
925238056 2:2296714-2296736 GCATGGTGCCCTGGGGCAGCAGG - Intronic
926324375 2:11771647-11771669 GGATGAGGCCATGGAGCTGCTGG + Exonic
926598685 2:14818153-14818175 CCATGGTTCCATGGTGCTGGTGG - Intergenic
927886850 2:26724097-26724119 CCAGGGGGCCCTGGAGCTTCTGG - Intronic
929664422 2:43822739-43822761 CCATGGAGTCATGGAGCTAGTGG - Intronic
930261391 2:49150743-49150765 CCATGGTGCCATGGTGCCTCAGG + Intronic
932128556 2:69167327-69167349 CCGTGTTGCCATGGTGCCGCAGG + Intronic
932626154 2:73297524-73297546 TCCTGGGGCCATGGAGATGCAGG + Intergenic
932987911 2:76748823-76748845 CCTTGGTGACATGGAGTGGCTGG + Exonic
937081670 2:119144778-119144800 CCCTGGTCCCCTGCAGCTGCTGG + Intergenic
939909404 2:147962383-147962405 CAATGGTGCCATGCTGCAGCAGG - Intronic
940895924 2:159081812-159081834 CCATGGGGCCAGGGAGGAGCTGG - Intronic
940979795 2:159988970-159988992 CCATCTTGCCATGGCGATGCTGG - Intronic
941007243 2:160260839-160260861 CCATGGTGACAAGAAGCTGTTGG - Intronic
942454842 2:176130516-176130538 CGCTGTTGCCATAGAGCTGCAGG - Exonic
946060552 2:216937320-216937342 CTATGCTGCCCTGGAGCTTCTGG - Intergenic
947878105 2:233480941-233480963 CCGGGGGGCCATGGATCTGCGGG + Intronic
948381876 2:237556417-237556439 CCCAGATGCCATTGAGCTGCAGG - Intergenic
948896902 2:240931841-240931863 CAACGGTGCCATACAGCTGCAGG + Intronic
949009465 2:241670325-241670347 CCAAGCTTCCAGGGAGCTGCTGG + Intronic
1169343897 20:4815263-4815285 CCATGGTGCCACGTAGTTGGGGG - Intronic
1170159691 20:13298757-13298779 TGATGGTGCCAGGGGGCTGCAGG + Intronic
1171183363 20:23107484-23107506 TCATGGCGCCATGGGGCTGCAGG + Intergenic
1172113554 20:32561203-32561225 CCCTGGTGACAGGGGGCTGCTGG - Intronic
1172126696 20:32628774-32628796 CAAGGGTCCCCTGGAGCTGCAGG + Intergenic
1173250483 20:41361873-41361895 CCACAGTGCCATTGAGCTGCTGG + Exonic
1174515561 20:51089581-51089603 GCCTGTTGCCATGGAGATGCTGG + Intergenic
1174567440 20:51475645-51475667 CCATGTAGCCATGGAGCTGGTGG + Exonic
1175119370 20:56706542-56706564 CCATGTGGCCCTGGAGCTCCTGG - Intergenic
1175864582 20:62168430-62168452 CCATGGTGCAGTGGAGAGGCTGG + Intronic
1178985050 21:37296324-37296346 CAATGGTTGCCTGGAGCTGCGGG + Intergenic
1180795358 22:18601451-18601473 GCATGGTGGCATGCACCTGCAGG + Intergenic
1181226382 22:21393861-21393883 GCATGGTGGCATGCACCTGCAGG - Intergenic
1181252268 22:21540977-21540999 GCATGGTGGCATGCACCTGCAGG + Intergenic
1181494381 22:23279758-23279780 CCATGGCTCCATGGAGATGCTGG - Intronic
1182696098 22:32200255-32200277 CCATGGGGGCCTGGAGCTGCAGG + Intronic
1182716001 22:32356630-32356652 CCATGGGGGCCTGGAGCTGCAGG - Intronic
1183403784 22:37620001-37620023 CCATGGTGCCATCTAGCAGGTGG + Intronic
1183684593 22:39354435-39354457 CCTTGGTGCCATGGATATCCAGG - Intronic
1184089588 22:42285164-42285186 CCCTGGTGCCACGGGGCAGCTGG + Intronic
1184414228 22:44342819-44342841 CCATGGTGCCCTGGGGCAGAAGG - Intergenic
1184512972 22:44943806-44943828 GCATGGTGCCAGGGTGCCGCTGG - Intronic
1184649069 22:45911410-45911432 GCATGGTGTCCTGGGGCTGCTGG - Intergenic
1185140029 22:49095067-49095089 CCGTGGTGACACGGAGCTTCGGG - Intergenic
1185282013 22:49976170-49976192 CTGTGGGGCCATGGGGCTGCTGG + Intergenic
1185392222 22:50568723-50568745 CCATGCTGACAAGAAGCTGCGGG + Intergenic
950225812 3:11233684-11233706 CCATGTTGGCATTGAGCTCCTGG - Intronic
950261163 3:11544202-11544224 CCATGCTGCGATGGGGCTCCGGG + Intronic
950589698 3:13928084-13928106 CCTTGGAGCCATGAAGATGCAGG + Intergenic
952341827 3:32453655-32453677 CCATGGCGGCCTGGGGCTGCTGG + Intronic
953404727 3:42654674-42654696 CCATGGTGCCGTGGCGCTGGGGG - Intronic
953454703 3:43032392-43032414 CCCTGGTCCCATGGAGCCTCAGG + Exonic
953687015 3:45085841-45085863 CCATGGTGCCCTGGAACGGCCGG + Exonic
954212551 3:49106246-49106268 CCACGGGGCCATGGAGATGTGGG - Intergenic
954364727 3:50139760-50139782 CCAAGGTACCAAGGAGCTGAGGG - Intergenic
955558616 3:60164364-60164386 CCATGCAGCCATGGCACTGCTGG + Intronic
955634872 3:61016662-61016684 TGATGGAGCCATGGAGCTGAGGG - Intronic
956121142 3:65967139-65967161 CCATGGTGCCTTTGAAATGCTGG + Intronic
960559987 3:119073437-119073459 CCATGGTGCCATGGAGCAGGTGG + Intronic
960852841 3:122074093-122074115 GCATGGGGGCAGGGAGCTGCCGG - Intronic
960917958 3:122716406-122716428 ACATGGTGCCTTGCAGATGCAGG - Intronic
961677076 3:128574195-128574217 CCCTGTGGCCATGGAGCTCCTGG - Exonic
964662326 3:159134157-159134179 CCAGCATGGCATGGAGCTGCAGG - Intronic
966065971 3:175822347-175822369 GCATGGTGCCAGGAAGGTGCTGG - Intergenic
966852892 3:184175425-184175447 AGATGGTGCCATGGGGGTGCGGG - Intronic
967054175 3:185813805-185813827 CCAGGGGGCAATGGGGCTGCAGG + Intronic
967828729 3:193900564-193900586 TCATTGTGCCATGGAGATGAGGG + Intergenic
969167441 4:5329310-5329332 CCATGGTGACATGGATGGGCAGG - Intronic
969449722 4:7266112-7266134 CCCTGGTGCCACAGAGCTGAGGG + Intronic
969578765 4:8051752-8051774 CCATGGTGCCAGGGACATGTGGG - Intronic
971222972 4:24725821-24725843 CCATGGGGCGATGGTGCAGCAGG + Intergenic
978006654 4:103625666-103625688 CCTTGGTGCCAGGAAGCTCCCGG + Intronic
981025265 4:140071364-140071386 GGATGGTTTCATGGAGCTGCAGG - Intronic
982028088 4:151272257-151272279 CCATTGTACCATGAAGGTGCTGG - Intronic
982205114 4:152991925-152991947 CCATGGACCCATAAAGCTGCTGG - Intergenic
985528989 5:422791-422813 CCATGGCCCAGTGGAGCTGCCGG - Exonic
988489936 5:31697710-31697732 TCCTGGTACCATGGAGCAGCTGG - Intronic
992200036 5:74374214-74374236 CCATGGTGTCATGTGGTTGCTGG - Intergenic
992748663 5:79842492-79842514 CCATGGTGACAGAGAGCTGTTGG - Intergenic
998402043 5:141853202-141853224 CCATGGTGGGATGGGGGTGCAGG - Exonic
1000037524 5:157460311-157460333 CCCGGGCCCCATGGAGCTGCGGG + Exonic
1000442198 5:161277309-161277331 CCATGTTGCCATACAGCTTCAGG + Intergenic
1001417383 5:171555577-171555599 CCCTGGTGCCATGGAGCCCTGGG + Intergenic
1002100481 5:176855270-176855292 GCATGGAGCCCTGGAGTTGCCGG - Intronic
1002198701 5:177514804-177514826 CCAGGATGCCATGGGTCTGCCGG + Exonic
1003976841 6:11352547-11352569 CCATGATGCCATGTTGCTGGTGG - Intronic
1007305772 6:40903041-40903063 CCAGTGTGCCAAGGTGCTGCAGG - Intergenic
1015943310 6:138474058-138474080 CTATGGTGCCATGGATCTCGGGG + Intronic
1019324708 7:432424-432446 CCAAGCTGCCCTGGAGCTGTGGG + Intergenic
1019523889 7:1472212-1472234 CCTGGGTCCCATGGGGCTGCGGG - Intronic
1019611713 7:1940100-1940122 CCATCGTGCCATGGGGCCGGAGG - Intronic
1021340524 7:19458012-19458034 CCATTGAGCCATGGAGCATCAGG - Intergenic
1029108137 7:98194992-98195014 CCATGGTGGCATGAACCTGTGGG - Intronic
1032423098 7:131799009-131799031 CCATGGAGCCATGGTCCTTCTGG + Intergenic
1032518693 7:132526271-132526293 CCATGGGGCCATGGTGATGGAGG - Intronic
1033246443 7:139720361-139720383 CCCTGGGCCCATGGATCTGCTGG + Intronic
1034327510 7:150250015-150250037 CAATGGGGCCAGGGAGCTGCAGG + Intronic
1034765702 7:153719430-153719452 CAATGGGGCCAGGGAGCTGCAGG - Intergenic
1035650323 8:1259215-1259237 CCAAGGTGCCAATGAGCCGCAGG + Intergenic
1037558986 8:20055057-20055079 ACCTGGTGCCATGGAGCAGGGGG - Intergenic
1039182351 8:34880611-34880633 CCTGGGTGCCATGAAGCTGTGGG - Intergenic
1039217729 8:35291486-35291508 CCATGGGCCTATGGAGCTGATGG + Intronic
1040110494 8:43565033-43565055 CCAGGGGGCCATGGAGTTCCTGG - Intergenic
1043301242 8:78735779-78735801 CCATGTTGCCATGTAGCTATTGG + Intronic
1045223315 8:100220021-100220043 ACATGCTGCCAGGGAGCTCCCGG + Intronic
1046685010 8:117215385-117215407 CCCTGATGCCATGAAGCTGAAGG - Intergenic
1048297194 8:133223142-133223164 CCTTGCTGCCCTGGGGCTGCTGG - Intronic
1049105266 8:140608792-140608814 CCTTGCTGCCCTGGAGCAGCTGG - Intronic
1049581242 8:143412047-143412069 CCCTGGTGCCAGGGTCCTGCTGG - Intergenic
1049849166 8:144821560-144821582 CCGAGGGGCCCTGGAGCTGCCGG - Intergenic
1051417090 9:16853269-16853291 CCGTGGTGGCATGCAGCTGTAGG + Intronic
1054142955 9:61543063-61543085 CCATGGTCCAAGGTAGCTGCTGG + Intergenic
1055318270 9:75055838-75055860 AGATGGTGGCATGGAGCTCCAGG + Intergenic
1057847449 9:98536636-98536658 CCATTGTGGCATGGAGGTGCAGG - Intronic
1058937445 9:109781937-109781959 TAATGGTGCCATGTAGCTGGTGG + Intronic
1059245880 9:112849140-112849162 CCAAGGTGCAATGGAACAGCAGG - Intronic
1061130175 9:128703927-128703949 CAAAGGTCCCATGGAGCTGGGGG - Intronic
1061131826 9:128712828-128712850 TCATGGTGCTTGGGAGCTGCAGG + Intronic
1061899463 9:133665665-133665687 CCATGGTCCTGTGGAGCTGTGGG - Intronic
1062628247 9:137452634-137452656 CCAGGGTGCTGTGGCGCTGCTGG - Intronic
1186836456 X:13443250-13443272 CCATGCTGCCATGGAGATCCTGG + Intergenic
1187213695 X:17254219-17254241 CCAGGCTGCCAGGCAGCTGCTGG - Intergenic
1187614896 X:20982063-20982085 CCATGTTGCCCTGCTGCTGCTGG + Intergenic
1189052367 X:37659638-37659660 CACTGGTGCCATGGCGCTCCAGG + Exonic
1189186710 X:39061185-39061207 CCATGGTGCCAAGGAACACCTGG + Intergenic
1189555610 X:42142218-42142240 CCATCCAGCCATGGAGCTGCTGG + Intergenic
1192169558 X:68845864-68845886 CCCTGGTGCCCTGGAACTGAAGG - Intergenic
1192575655 X:72241233-72241255 CCATGGTGGCATTGAGAGGCGGG + Intronic
1193457973 X:81754764-81754786 CCATGGTTCCATGCCGCTCCAGG - Intergenic
1202270222 Y:23065064-23065086 CCGTGGTGGCATGCACCTGCAGG - Intergenic
1202295805 Y:23355618-23355640 CCGTGGTGGCATGCACCTGCAGG + Intergenic
1202423216 Y:24698809-24698831 CCGTGGTGGCATGCACCTGCAGG - Intergenic
1202447573 Y:24971277-24971299 CCGTGGTGGCATGCACCTGCAGG + Intergenic