ID: 1069911415

View in Genome Browser
Species Human (GRCh38)
Location 10:71762071-71762093
Sequence TACTCCTGGCAACCCCAGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 127}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069911409_1069911415 22 Left 1069911409 10:71762026-71762048 CCTGCTCAGAGAGAGGAGAGCCC 0: 1
1: 0
2: 5
3: 25
4: 243
Right 1069911415 10:71762071-71762093 TACTCCTGGCAACCCCAGAGCGG 0: 1
1: 0
2: 2
3: 6
4: 127
1069911411_1069911415 1 Left 1069911411 10:71762047-71762069 CCTGTCACCTGACTGATCCAGTG 0: 1
1: 0
2: 1
3: 11
4: 85
Right 1069911415 10:71762071-71762093 TACTCCTGGCAACCCCAGAGCGG 0: 1
1: 0
2: 2
3: 6
4: 127
1069911406_1069911415 30 Left 1069911406 10:71762018-71762040 CCACCGGACCTGCTCAGAGAGAG 0: 1
1: 0
2: 0
3: 5
4: 142
Right 1069911415 10:71762071-71762093 TACTCCTGGCAACCCCAGAGCGG 0: 1
1: 0
2: 2
3: 6
4: 127
1069911408_1069911415 27 Left 1069911408 10:71762021-71762043 CCGGACCTGCTCAGAGAGAGGAG 0: 1
1: 0
2: 2
3: 29
4: 235
Right 1069911415 10:71762071-71762093 TACTCCTGGCAACCCCAGAGCGG 0: 1
1: 0
2: 2
3: 6
4: 127
1069911412_1069911415 -6 Left 1069911412 10:71762054-71762076 CCTGACTGATCCAGTGCTACTCC 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1069911415 10:71762071-71762093 TACTCCTGGCAACCCCAGAGCGG 0: 1
1: 0
2: 2
3: 6
4: 127
1069911410_1069911415 2 Left 1069911410 10:71762046-71762068 CCCTGTCACCTGACTGATCCAGT 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1069911415 10:71762071-71762093 TACTCCTGGCAACCCCAGAGCGG 0: 1
1: 0
2: 2
3: 6
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069911415 Original CRISPR TACTCCTGGCAACCCCAGAG CGG Intronic
908504469 1:64782623-64782645 TGCATCTGGCAACCCCAAAGAGG + Intronic
913705250 1:121415067-121415089 TGCTGCTGGCAACAGCAGAGTGG - Intergenic
916518849 1:165545053-165545075 TACTCCAGTCAACCCAAGGGTGG - Intronic
916673704 1:167047707-167047729 TGTTCCTGGCAAGGCCAGAGGGG + Intergenic
920535241 1:206732869-206732891 TGGTTCTGGCCACCCCAGAGTGG + Exonic
923182361 1:231531948-231531970 TAGTCCTGGCTACTCCGGAGGGG + Intronic
1064928242 10:20593911-20593933 GACTCCAGGCAACTCTAGAGAGG - Intergenic
1066612553 10:37265361-37265383 TGCTGCGGGCAACCCCAGGGTGG - Intronic
1069911415 10:71762071-71762093 TACTCCTGGCAACCCCAGAGCGG + Intronic
1074919537 10:117993308-117993330 AACTCCTGACAACCCCAGAGGGG + Intergenic
1075895295 10:125989884-125989906 GACTCCGGGCAACCCCAGCCAGG + Intronic
1076223057 10:128750130-128750152 TGCTGCTGGAAACCCCAAAGTGG - Intergenic
1078076019 11:8161547-8161569 AACTCCTCTCAACTCCAGAGTGG + Intronic
1080426432 11:32158865-32158887 TTCTTCTGGCAACCCCAAAATGG - Intergenic
1080467465 11:32511161-32511183 TGTACGTGGCAACCCCAGAGTGG - Intergenic
1080662831 11:34311357-34311379 TAGTCCTGAGAACACCAGAGTGG + Intronic
1082763045 11:57145169-57145191 TCCTCCTTGCAACCCTAGAAGGG + Intergenic
1084893059 11:72245841-72245863 TCCTCCTGGGAAGCCCAGAACGG - Intergenic
1087701652 11:101442179-101442201 TGCGACTTGCAACCCCAGAGGGG - Intergenic
1087812343 11:102622218-102622240 GGCTCCTGGAAACACCAGAGAGG - Intronic
1090404633 11:126469386-126469408 CACTCCTGACTTCCCCAGAGAGG - Intronic
1095575335 12:43731409-43731431 CACCCCTGGCAACCCCTGATCGG - Intronic
1102074747 12:110050898-110050920 TATTTCTGGCAACCACAGAAGGG + Intronic
1103796171 12:123504624-123504646 TACTCCTGCCAAGCCCAGGAAGG + Intronic
1104127706 12:125863164-125863186 TCTTCCTGGCAACCACAGAAGGG - Intergenic
1105210179 13:18252894-18252916 TGCTCTTGGGAACCCCCGAGGGG + Intergenic
1109257375 13:60099656-60099678 TTCCCCTGGCAAGCCGAGAGTGG - Intronic
1109819043 13:67627621-67627643 TCCTTCAGGCAGCCCCAGAGTGG + Intergenic
1113959428 13:114118253-114118275 GCCTCCTGGGAACCCCAGGGGGG + Intronic
1116152257 14:41155585-41155607 AACTCCTGGCAACCACAAATCGG - Intergenic
1117582666 14:57168600-57168622 TACTACGGACAATCCCAGAGTGG + Intergenic
1120737958 14:88076552-88076574 TTCTCATGGCCACCACAGAGAGG + Intergenic
1121547250 14:94771252-94771274 TCCGCCTGGCAGGCCCAGAGTGG + Intergenic
1122270335 14:100566136-100566158 CACCCCTGGCAACTCCAGAAAGG + Intronic
1125518430 15:40335578-40335600 CAGCCCTGGCATCCCCAGAGGGG - Exonic
1126786982 15:52185389-52185411 TTCTCTTGACAACCCCAGAAGGG - Intronic
1129169155 15:73797383-73797405 CACTACTGGCTACCCCCGAGTGG - Intergenic
1129951424 15:79595450-79595472 TCCTCCTGGGAAGCACAGAGGGG - Intergenic
1133171422 16:3984738-3984760 ACCTTCTGGCAACCCCTGAGAGG + Intronic
1137606042 16:49787544-49787566 TACTCCCAGGCACCCCAGAGAGG + Intronic
1140949275 16:79800597-79800619 GGCTCCTAGCAGCCCCAGAGTGG + Intergenic
1141253866 16:82382998-82383020 TCCTCAAGGCAACCCCCGAGGGG + Intergenic
1141683613 16:85557624-85557646 TCCTCCTGGGGACTCCAGAGAGG - Intergenic
1141952956 16:87350822-87350844 GACGCCTGGCAATCCCAAAGTGG + Intronic
1142129500 16:88426256-88426278 TCCTCATGGCAGGCCCAGAGAGG - Intergenic
1142243454 16:88957555-88957577 TACATCTGGGAAGCCCAGAGAGG + Intronic
1145886897 17:28388199-28388221 TACTGGTGGCAAACCCAGTGGGG + Exonic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1151569175 17:74917575-74917597 TCCTCCCGTCCACCCCAGAGGGG - Exonic
1152356702 17:79811072-79811094 TCTGCCTGGAAACCCCAGAGTGG - Intergenic
1159701978 18:71640545-71640567 TGCTCCTGCCAGCCCCAAAGCGG - Intergenic
1160898189 19:1412601-1412623 ACCTCCTGGCAGCACCAGAGTGG - Intronic
1161310873 19:3593242-3593264 GGCTCCTGGCTCCCCCAGAGTGG - Exonic
1161359337 19:3838541-3838563 TCCTCCTGGCAGCCAGAGAGGGG + Intronic
1165434559 19:35788923-35788945 TACTCCTGGGAGCCTCTGAGAGG + Intergenic
1166531465 19:43545953-43545975 TCCTCTTGGCACCCCCAGGGTGG - Exonic
926124410 2:10263126-10263148 CTCTCATGGCGACCCCAGAGGGG - Intergenic
928389450 2:30897919-30897941 TGCCCCAGGCAACCCCACAGGGG + Intergenic
928883759 2:36125860-36125882 AACTACTGGGATCCCCAGAGGGG + Intergenic
929051797 2:37843341-37843363 CTTTCCTGGCAACCCCAAAGAGG + Intergenic
931230681 2:60372085-60372107 TACTTCGGGCAACCCCTGGGAGG + Intergenic
933785642 2:85839043-85839065 CACTACTGGCATCCACAGAGAGG + Intergenic
935620576 2:105126131-105126153 TCCTCCTCCCAACTCCAGAGGGG + Intergenic
935691604 2:105736903-105736925 TAATCCTGACAACCCCAGTGAGG - Intergenic
939096257 2:137836836-137836858 TAATGCTAGCCACCCCAGAGAGG + Intergenic
940775438 2:157878652-157878674 TATTCCTGGCAACCACAGAAGGG + Intronic
946236564 2:218327852-218327874 TTCTCCTGGCTGGCCCAGAGTGG - Intronic
946488616 2:220126006-220126028 AACCCCAGTCAACCCCAGAGGGG + Intergenic
948012521 2:234661345-234661367 GACTCCTGGCAAAGACAGAGGGG + Intergenic
948453775 2:238094649-238094671 TGCTCTTGGCAACCCCAGCAAGG - Intronic
1169093097 20:2873307-2873329 TTCTCCTGGTAGCTCCAGAGGGG - Intronic
1169962072 20:11171822-11171844 TACTCCTTGCCACTCCACAGTGG - Intergenic
1171028815 20:21657408-21657430 TCCTTCTGGCAACCACAGAAGGG + Intergenic
1172277577 20:33688209-33688231 TTCTCCTGGCAACCCTGGAAGGG - Intergenic
1173249757 20:41358219-41358241 TGGTTCTGGCCACCCCAGAGAGG + Exonic
1174449110 20:50609020-50609042 TACTCGGGGGAACCCCAGAGAGG - Intronic
1176257934 20:64162355-64162377 TCCTCCTGGCAGCGCCACAGAGG + Intronic
1184679386 22:46061969-46061991 TCCTCCAGGCAGCCCCAGGGCGG - Intronic
951633881 3:24751834-24751856 TCCTGCTCTCAACCCCAGAGTGG - Intergenic
952123692 3:30275153-30275175 TATTTCTGGCAACCACAGAAGGG + Intergenic
954949217 3:54454398-54454420 CACTCCTGGCAACCACTGATTGG + Intronic
956407373 3:68941990-68942012 TACTCATTGCAGCCACAGAGGGG + Intergenic
956796501 3:72723022-72723044 CAGTCCTTGCAACGCCAGAGGGG + Intergenic
966147077 3:176824033-176824055 TATTTCTGGCAACCACAGAATGG - Intergenic
967229290 3:187322424-187322446 TTCTCCTGAGAAACCCAGAGCGG + Intergenic
967895246 3:194390111-194390133 TACTCAATGGAACCCCAGAGAGG + Intergenic
968502182 4:955955-955977 TCATCCTGGAAACCCCAGAAAGG + Intronic
969543508 4:7808861-7808883 TACTCGTGGCAAGGGCAGAGGGG - Intronic
969875249 4:10131440-10131462 CACTCCTGGCACCCTGAGAGAGG - Intergenic
974630450 4:64481032-64481054 CACTCCTGGCAGCCACAGGGTGG - Intergenic
975176878 4:71299621-71299643 TTGTTCTGGAAACCCCAGAGAGG - Intronic
982072575 4:151708267-151708289 TACTTCTGGCCACTCGAGAGGGG + Intronic
984892801 4:184508589-184508611 TACTTCTAAGAACCCCAGAGTGG + Intergenic
985333683 4:188868969-188868991 GACACCTGGCAGCCACAGAGAGG - Intergenic
989973524 5:50553812-50553834 TGCTACTGGCAACAGCAGAGTGG + Intergenic
990863093 5:60350288-60350310 GACTCCTGGCAACCTCATACTGG + Intronic
992857286 5:80875496-80875518 TACCCCTGCCAGCCCCAGAGGGG - Intronic
994054559 5:95400805-95400827 TCTTCCGGGCAACCTCAGAGAGG + Intronic
998253633 5:140568756-140568778 TTGTTCTGGAAACCCCAGAGAGG + Exonic
1000639646 5:163686356-163686378 TGTTCCTGGCAAGCTCAGAGAGG + Intergenic
1001716872 5:173823737-173823759 TCCTCCTGGCAAAATCAGAGAGG - Intergenic
1002181435 5:177433005-177433027 TCCTCCTGCTAACCCCTGAGCGG - Intronic
1002434579 5:179222802-179222824 GACTCCTGCCAAGCCCTGAGAGG + Intronic
1003100786 6:3175014-3175036 GAGTCCTGCCTACCCCAGAGTGG - Intergenic
1003786039 6:9488054-9488076 TACTCCTTGCAACAAGAGAGAGG + Intergenic
1008199999 6:48574276-48574298 TACTCTTGGGAAACCCATAGTGG + Intergenic
1013864379 6:114677392-114677414 TAAACTAGGCAACCCCAGAGGGG - Intergenic
1015050882 6:128837923-128837945 TCCTGCTGGCAACCCAGGAGTGG + Intergenic
1017723495 6:157260938-157260960 TTCTCCTGGCAAGGGCAGAGGGG - Intergenic
1017816905 6:158022579-158022601 TCCTCCTGGGAGGCCCAGAGAGG + Intronic
1019146858 6:169981278-169981300 TCCTGCTGCCCACCCCAGAGGGG - Intergenic
1022762146 7:33366155-33366177 TCCACCAGGGAACCCCAGAGAGG - Intronic
1023518366 7:41026232-41026254 TACTCCTGGCAACCACCGAATGG + Intergenic
1024493695 7:50017198-50017220 GTCTCCTGTCAACCCCAGATGGG - Intronic
1034029068 7:147740066-147740088 TTCTCCAGGCATCCACAGAGGGG + Intronic
1035470342 7:159105284-159105306 CACTCCTGGCACAGCCAGAGCGG + Intronic
1039777411 8:40750779-40750801 GATTCCTGGCCACCCCAGTGGGG + Intronic
1042198766 8:66258960-66258982 TCCTCCAGGGAACCCCAGAGAGG + Intergenic
1042664821 8:71193526-71193548 TATTCCTGGAAAACCCAAAGAGG + Intergenic
1048301209 8:133252680-133252702 TACACTTGCCAACTCCAGAGTGG + Intronic
1049213944 8:141399205-141399227 TACTCCTGGCACCCCCACTCTGG + Intronic
1049808886 8:144554320-144554342 TACTCCTGACATCCCCAGAGAGG + Intronic
1051371967 9:16366402-16366424 GACACCAGGCAAGCCCAGAGAGG - Intergenic
1055936307 9:81607672-81607694 CACTGCTGGCAACCACAGATAGG + Intronic
1055936387 9:81608266-81608288 CACTGCTGGCAACCACAGATAGG + Intronic
1056246991 9:84705519-84705541 TGCTGCTGGCAGCCCCACAGAGG + Intronic
1057805260 9:98215378-98215400 TCCTCCTAGCAACCCTAGAAGGG + Intronic
1060232449 9:121835701-121835723 TACTGCTGGCCACAGCAGAGTGG + Intronic
1060749568 9:126160116-126160138 CTCTCCTTGCATCCCCAGAGTGG + Intergenic
1061166923 9:128928309-128928331 TACTCCTAGGAACCCTTGAGTGG - Intronic
1062089332 9:134666677-134666699 TCCTCCAGGCACCCCCAGTGAGG - Intronic
1188373187 X:29393927-29393949 TATTGCTGGCAAACCCAAAGAGG + Intronic
1188930255 X:36100614-36100636 CACACCTTGCAACCCCAGACGGG + Intronic
1190947342 X:55108923-55108945 TATTTCTGGCAACCACAGAAGGG + Intronic
1198673418 X:139106225-139106247 GCCTCCTGGCAACTCCACAGAGG + Intronic
1200906130 Y:8484723-8484745 TTCTCAAGGCAAGCCCAGAGAGG - Intergenic