ID: 1069913059

View in Genome Browser
Species Human (GRCh38)
Location 10:71771527-71771549
Sequence CCTAGGACAGTGTGCACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069913059 Original CRISPR CCTAGGACAGTGTGCACTGA GGG (reversed) Intronic
900327226 1:2114278-2114300 CCAAGCACAGTGTCCAATGAGGG + Intronic
904648917 1:31989525-31989547 CATACTGCAGTGTGCACTGATGG - Intergenic
904917021 1:33977475-33977497 CCTAAGAGAGAGTGCCCTGATGG - Intronic
909635097 1:77808735-77808757 CCTTGGCCAGTGAGCAATGAAGG + Intronic
912148090 1:106819085-106819107 CCGAGGCCAGTCTGCCCTGATGG - Intergenic
912225541 1:107729540-107729562 CCTACGACATGGTGCACTGAAGG + Intronic
915492803 1:156260742-156260764 CCTAGGACAGTGCGGAGAGATGG + Intronic
916510358 1:165467742-165467764 GCTTGGAGAGAGTGCACTGAGGG - Intergenic
917289851 1:173460955-173460977 CCTGGGACAGAGTGCCCAGAGGG + Intergenic
922479422 1:225928701-225928723 CCTAGGACAGGGAGGATTGAGGG - Intergenic
1063141191 10:3257875-3257897 CCTTGAACAGTGTGCACTTGAGG - Intergenic
1063221511 10:3972917-3972939 CCTTGGGCAGTGTGCACCAATGG - Intergenic
1069390450 10:67929563-67929585 CCTATGACAGAGTGCAGTCAGGG + Intronic
1069913059 10:71771527-71771549 CCTAGGACAGTGTGCACTGAGGG - Intronic
1073121329 10:101123998-101124020 CATAGGGCTGTGTGCACGGAGGG + Intronic
1075060898 10:119256145-119256167 CCTGGGACAGTGTGCAGTGGAGG - Intronic
1075271498 10:121055811-121055833 CCTAGGAGAGAGTGTACTAATGG + Intergenic
1076443254 10:130495010-130495032 GCCAGGACAGGGTGCTCTGAAGG + Intergenic
1078560028 11:12363417-12363439 CCTAGGTCAGTGTGATCTGGAGG - Intergenic
1086328402 11:85728327-85728349 CCTAGGCCAGAGTGCAGTGGCGG + Intronic
1089410905 11:118241962-118241984 CCTAAGAAAGTGGGGACTGAGGG - Intronic
1090808506 11:130217678-130217700 CCTGGGGCAGTGTGGACTGGAGG + Intergenic
1091212615 11:133875064-133875086 CCTATGACATTGTGCTCTGCTGG + Intergenic
1092598613 12:10034674-10034696 CCTAGCAGAGTGTGCAATGGAGG + Intronic
1093151136 12:15623204-15623226 CTGAGGACAGTCTGCCCTGAAGG - Exonic
1093433715 12:19111722-19111744 CTTAGTACATTGTGCAATGATGG - Intergenic
1095040047 12:37431412-37431434 TCTGGGACAGCGTGCACTGTAGG - Intergenic
1096210071 12:49758433-49758455 CCTGGCATAGAGTGCACTGAGGG - Exonic
1097723765 12:63051303-63051325 CCTAGTAAAGTGTTCACAGAAGG + Intergenic
1098295767 12:69002504-69002526 CCTAGCACAATGTGGGCTGAGGG + Intergenic
1100091851 12:90982673-90982695 CATAGGACAGAGTGGAATGATGG - Intronic
1103879028 12:124151840-124151862 CCTAGGTTAATGAGCACTGAGGG + Intronic
1106800987 13:33255535-33255557 CATAGTACAGTGTGCCTTGATGG + Intronic
1118473271 14:66094311-66094333 CCCAGGGCAGTGGGCTCTGAGGG + Intergenic
1121722554 14:96120539-96120561 CCTATAACAGTGTGCACTCTTGG + Intergenic
1202840265 14_GL000009v2_random:114827-114849 CCTAGGTCTGTGTTCCCTGAAGG - Intergenic
1202909648 14_GL000194v1_random:105024-105046 CCTAGGTCTGTGTTCCCTGAAGG - Intergenic
1124406972 15:29401868-29401890 CACAGCCCAGTGTGCACTGAAGG + Intronic
1125814380 15:42571968-42571990 CATTGGATATTGTGCACTGAGGG - Intergenic
1129314549 15:74733410-74733432 TCTAGGACAGTGGGCAGAGAAGG + Intergenic
1132032827 15:98452293-98452315 CATTGAACAGTGTGCAGTGAAGG - Intronic
1132081528 15:98870026-98870048 CCTAGTACAGTGTACACTAGTGG + Intronic
1132740242 16:1408462-1408484 CCTAGGAAAGGGTGCACAGTGGG + Intronic
1133601906 16:7347899-7347921 CACAGGATAGGGTGCACTGAAGG - Intronic
1137621642 16:49880268-49880290 GCTAGGACAGTGTGGCCAGATGG + Intergenic
1137788194 16:51153754-51153776 CCTGGGACAGTGTGGATTGGTGG - Intergenic
1139354542 16:66359815-66359837 CAGAGTGCAGTGTGCACTGAGGG + Intergenic
1140614176 16:76640093-76640115 CCCAGGCCAGTGAGCAATGAGGG + Intergenic
1142379497 16:89723348-89723370 CGGAGGACAGTGTCCTCTGAAGG - Exonic
1143216764 17:5230896-5230918 CCCAGGCTAGAGTGCACTGATGG - Intronic
1144334005 17:14252975-14252997 CCGAGGTCATTGTGCACAGATGG + Intergenic
1146494947 17:33313283-33313305 CCCAGGGCAGAGTGCAGTGACGG - Intronic
1148454067 17:47801511-47801533 CATAGGACAGAGAGGACTGAGGG - Intergenic
1153520939 18:5953280-5953302 CCTAGAAGAGTGGGCCCTGAGGG + Intergenic
1157583047 18:48784397-48784419 CCGAGTATAGTGTGCACTGGGGG + Intronic
1159914619 18:74177267-74177289 CCGAGGACAGTGGCCAGTGAAGG + Intergenic
1163653904 19:18534431-18534453 CCAAGCTAAGTGTGCACTGATGG - Intronic
1163762028 19:19142469-19142491 TCTAGGACTGTGTGCGCTAAGGG + Intergenic
1164729605 19:30493123-30493145 CCCAGAACTATGTGCACTGAGGG - Intronic
1165247631 19:34506282-34506304 CCTTCCACAGTGTGCACTGAGGG + Exonic
928274893 2:29891718-29891740 CCCAGGGAAGTGTGAACTGATGG - Intronic
935217275 2:100984081-100984103 CCTATGCCACAGTGCACTGAGGG + Intronic
938116018 2:128603438-128603460 CCCAGGACCGTGTGCTCAGAAGG - Intergenic
938731029 2:134147742-134147764 CCTATGACTGTGTTCACTGATGG + Intronic
941262597 2:163316366-163316388 CCCAGGTCATTGTGCACAGAGGG - Intergenic
948884405 2:240875610-240875632 CCTAGCCCAGTGGGCACAGAGGG + Intronic
949034686 2:241811044-241811066 CAGAGGAGAGTGTGCACTCACGG + Exonic
1171534613 20:25876096-25876118 TCTGGGACAGTGTGCACTGTAGG - Intergenic
1171573270 20:26273839-26273861 TCTGGGACAGCGTGCACTGTAGG + Intergenic
1171806458 20:29684828-29684850 TCTGGGACAGCGTGCACTGTAGG + Intergenic
1173836066 20:46126733-46126755 CCTAGGAAGGTGGGAACTGAAGG + Intronic
1174690940 20:52503892-52503914 ACTCGGCCAGTGTCCACTGAAGG + Intergenic
1175809803 20:61851892-61851914 CCTAGATTACTGTGCACTGAAGG - Intronic
1176333288 21:5570896-5570918 CCTGGGACAGAGTACACTGGTGG - Intergenic
1176394469 21:6250056-6250078 CCTGGGACAGAGTACACTGGTGG + Intergenic
1176442688 21:6739048-6739070 CCTGGGACAGAGTACACTGGTGG - Intergenic
1176466950 21:7066118-7066140 CCTGGGACAGAGTACACTGGTGG - Intronic
1176490511 21:7447896-7447918 CCTGGGACAGAGTACACTGGTGG - Intergenic
1176510131 21:7690487-7690509 CCTGGGACAGAGTACACTGGTGG + Intergenic
1180573983 22:16755646-16755668 TCTGGGACAGCGTGCACTGTAGG - Intergenic
1184453539 22:44596808-44596830 CCTAGGACGGTGCCCACTGCAGG + Intergenic
1184853040 22:47131749-47131771 CCAGGGTCACTGTGCACTGATGG - Intronic
952344438 3:32470743-32470765 CCCAGCACAGTGTGAACTGCTGG + Intronic
952428662 3:33201239-33201261 CCTAGGGCTGGGTGCACTCAGGG - Intronic
960056076 3:113277421-113277443 CCCAGGATAGGGTGCAATGATGG + Intronic
962300046 3:134231718-134231740 TCCAGGGCAGTGTCCACTGAGGG - Intronic
963010542 3:140766079-140766101 CCTAGGACAGTGTTCTCAGATGG + Intergenic
963051815 3:141149544-141149566 GCCAGCACAGTGTGCACAGAAGG - Intergenic
963632854 3:147755242-147755264 CCTAGGACATTTTTCAGTGATGG - Intergenic
964204349 3:154155718-154155740 CCTAAGACTTTGTTCACTGAGGG - Intronic
966269786 3:178090854-178090876 CCTAGGACAGAGTTCTCAGAGGG + Intergenic
966745762 3:183275231-183275253 CCTTGTACAGTGTCCACTTAGGG + Intronic
966975170 3:185076496-185076518 CCTAGGACAGTGAGTACACATGG - Intergenic
967825106 3:193871203-193871225 CCCAGGACAGTGTGCACAGACGG + Intergenic
968343802 3:197982932-197982954 CCTCCGACAGTGTCCACTGAGGG - Intronic
970676327 4:18454576-18454598 CCCAGGTCAGAGTGCTCTGAAGG - Intergenic
970856097 4:20651000-20651022 CCACTGACAGTGTGGACTGATGG + Intergenic
973639967 4:52892857-52892879 CATCTGACAGTGTGCAGTGATGG - Intronic
975384350 4:73738096-73738118 TCTAGGACATAATGCACTGAAGG + Intergenic
975387268 4:73771913-73771935 CTTAGCACAGTGTTCACTGTTGG - Intergenic
975519482 4:75284408-75284430 TCTAGTACTGTGTGCACTCATGG - Intergenic
978251457 4:106636180-106636202 CCTACAACAGTGTGCTCTGAGGG + Intergenic
979296694 4:119040854-119040876 CCTAGGACAGTGTGGAAAGGAGG - Intronic
984409730 4:179381337-179381359 CCCAGGCCAGAGTGCAGTGATGG + Intergenic
990464730 5:56061188-56061210 CCTAGGAAGGTTTGCACTGATGG + Intergenic
990760116 5:59119885-59119907 CATAGGCCAGTGTGCAGTGGTGG + Intronic
992746638 5:79827162-79827184 CCAAGGACAGAGGGCACTGCTGG + Intergenic
993991918 5:94668181-94668203 CCAAGGACAGTGTGCAGTGGCGG + Intronic
994979454 5:106854966-106854988 CCTAGGTCATTGTGCACAGGGGG + Intergenic
997833412 5:137172591-137172613 TCTAGCACTGTGTGCACTGTAGG - Intronic
1002444745 5:179282970-179282992 CCTGGGAGAGGGTGCACAGAGGG + Intronic
1002979130 6:2117284-2117306 CCTAGGGCAGTGAGCAGGGAAGG + Intronic
1004008077 6:11655235-11655257 CCTAGGCCAGTAGACACTGAAGG + Intergenic
1005287826 6:24347681-24347703 CCTAGGACTGAGTATACTGAAGG + Intronic
1005813103 6:29531057-29531079 CCTAGGACAGTGTGTCCTGAAGG - Intergenic
1006218139 6:32463596-32463618 CCTATGACAGCGTGCACATAGGG + Intergenic
1007171841 6:39869545-39869567 CCTAGGCTAGAGTGCAATGATGG - Intronic
1009888763 6:69655865-69655887 CCTGGGACAGTGTTCCCAGAGGG + Intergenic
1013302712 6:108819107-108819129 CCCAGGATAGAGTGCAGTGATGG - Intergenic
1016926274 6:149351826-149351848 GATAAGACAGTGTGCACTTATGG + Intronic
1018041930 6:159932336-159932358 CCTAGGACTGAGGGCACAGAGGG - Intergenic
1018389742 6:163332858-163332880 TCTTGGACAGTCTTCACTGAAGG + Intergenic
1019794705 7:3041192-3041214 CCTAGTACAGTGTCCACAGGTGG + Intronic
1024330980 7:48155221-48155243 CCTATGACAGCGTGCACTTCAGG + Intergenic
1026822717 7:73560409-73560431 CCTAGCACAGTGGACACTGCAGG + Intergenic
1029390114 7:100269445-100269467 ACTAGGACAGCATGCCCTGAGGG - Intronic
1029503333 7:100947496-100947518 CCTAGGCCAGAGTGCAGTGGCGG + Intergenic
1034923215 7:155100509-155100531 CCTATGAAAGTGTGCAGTGTTGG + Intergenic
1037877455 8:22554923-22554945 CCCAGGACTGTGTGCAATGGGGG + Exonic
1038463346 8:27735639-27735661 GCTGGGACAGACTGCACTGAGGG + Exonic
1039043672 8:33431030-33431052 CCTTGGAAAGTGTGCATTGTGGG + Intronic
1040919920 8:52604857-52604879 CCTAGGTCATTGTGCACAGGGGG + Intergenic
1044142570 8:88673304-88673326 GCTATTACAGTGTTCACTGATGG - Intergenic
1047480582 8:125278314-125278336 GCCAGGACAGAGTGCTCTGAAGG - Intronic
1048566216 8:135600535-135600557 CCTAGGTGTGTGTGGACTGATGG + Intronic
1054816087 9:69476900-69476922 CCCAGGTCAGTGTACACAGAAGG + Intronic
1055232116 9:74078209-74078231 CCAATGAGAGTGTGCACTGGGGG + Intergenic
1055295364 9:74827684-74827706 ACTAGGAGAGTGAGCTCTGATGG + Intronic
1055733361 9:79302346-79302368 CCCAGGACAGAAAGCACTGAAGG + Intergenic
1060495903 9:124118436-124118458 CCTGCGTCACTGTGCACTGATGG + Intergenic
1061085923 9:128398323-128398345 CCCAGGCCAGAGTGCACTGGTGG - Intergenic
1062293178 9:135806959-135806981 CCTGCGTCAGTGTGCACTGTGGG - Intergenic
1203428408 Un_GL000195v1:64326-64348 CCTGGGACAGAGTACACTGGTGG + Intergenic
1203751840 Un_GL000218v1:87413-87435 CCTAGGTCTGTGTTCCCTGAAGG - Intergenic
1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG + Intronic
1189297012 X:39926030-39926052 ACCAGGAGAGTGTGCACAGAGGG - Intergenic
1191979606 X:66911409-66911431 CCTTGGACAGGGGGCAGTGAAGG + Intergenic
1199679537 X:150215494-150215516 CCGGGGACAGTGTGCACCCATGG + Intergenic
1199695694 X:150341555-150341577 CCGGGGACAGTGTGCACCCATGG - Intergenic
1199883508 X:151995749-151995771 TCCAGGGCAGTGTGCTCTGATGG - Intergenic
1201165495 Y:11205033-11205055 CCTAGGTCTGTGTTCCCTGAAGG - Intergenic