ID: 1069915671

View in Genome Browser
Species Human (GRCh38)
Location 10:71785205-71785227
Sequence CCCGTTCCTGCACTGGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069915656_1069915671 26 Left 1069915656 10:71785156-71785178 CCCTGCCCTAGAGGCTTTTCTGC 0: 1
1: 0
2: 2
3: 18
4: 177
Right 1069915671 10:71785205-71785227 CCCGTTCCTGCACTGGGATGAGG No data
1069915657_1069915671 25 Left 1069915657 10:71785157-71785179 CCTGCCCTAGAGGCTTTTCTGCT 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1069915671 10:71785205-71785227 CCCGTTCCTGCACTGGGATGAGG No data
1069915664_1069915671 1 Left 1069915664 10:71785181-71785203 CCACCATCTGGGCTCCACCGGGC 0: 1
1: 0
2: 1
3: 15
4: 153
Right 1069915671 10:71785205-71785227 CCCGTTCCTGCACTGGGATGAGG No data
1069915658_1069915671 21 Left 1069915658 10:71785161-71785183 CCCTAGAGGCTTTTCTGCTGCCA 0: 1
1: 0
2: 1
3: 13
4: 172
Right 1069915671 10:71785205-71785227 CCCGTTCCTGCACTGGGATGAGG No data
1069915665_1069915671 -2 Left 1069915665 10:71785184-71785206 CCATCTGGGCTCCACCGGGCTCC 0: 1
1: 0
2: 3
3: 28
4: 269
Right 1069915671 10:71785205-71785227 CCCGTTCCTGCACTGGGATGAGG No data
1069915659_1069915671 20 Left 1069915659 10:71785162-71785184 CCTAGAGGCTTTTCTGCTGCCAC 0: 1
1: 0
2: 5
3: 10
4: 221
Right 1069915671 10:71785205-71785227 CCCGTTCCTGCACTGGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069915671 Original CRISPR CCCGTTCCTGCACTGGGATG AGG Intronic
No off target data available for this crispr