ID: 1069920438

View in Genome Browser
Species Human (GRCh38)
Location 10:71812602-71812624
Sequence GCACCCATGTGAGCCAGAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 231}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069920428_1069920438 27 Left 1069920428 10:71812552-71812574 CCTACCGGAGAACCTGAGTGAGA 0: 1
1: 0
2: 2
3: 14
4: 297
Right 1069920438 10:71812602-71812624 GCACCCATGTGAGCCAGAGGCGG 0: 1
1: 0
2: 0
3: 18
4: 231
1069920429_1069920438 23 Left 1069920429 10:71812556-71812578 CCGGAGAACCTGAGTGAGATCGC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1069920438 10:71812602-71812624 GCACCCATGTGAGCCAGAGGCGG 0: 1
1: 0
2: 0
3: 18
4: 231
1069920433_1069920438 -3 Left 1069920433 10:71812582-71812604 CCTGTGGAACAGCCCCACGCGCA 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1069920438 10:71812602-71812624 GCACCCATGTGAGCCAGAGGCGG 0: 1
1: 0
2: 0
3: 18
4: 231
1069920432_1069920438 1 Left 1069920432 10:71812578-71812600 CCGACCTGTGGAACAGCCCCACG 0: 1
1: 0
2: 0
3: 11
4: 112
Right 1069920438 10:71812602-71812624 GCACCCATGTGAGCCAGAGGCGG 0: 1
1: 0
2: 0
3: 18
4: 231
1069920430_1069920438 15 Left 1069920430 10:71812564-71812586 CCTGAGTGAGATCGCCGACCTGT 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1069920438 10:71812602-71812624 GCACCCATGTGAGCCAGAGGCGG 0: 1
1: 0
2: 0
3: 18
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069920438 Original CRISPR GCACCCATGTGAGCCAGAGG CGG Exonic