ID: 1069922180

View in Genome Browser
Species Human (GRCh38)
Location 10:71822466-71822488
Sequence CCATTTAAAATGATGCATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069922174_1069922180 24 Left 1069922174 10:71822419-71822441 CCAAATGTGTTAGAAATAAAACC 0: 1
1: 0
2: 1
3: 34
4: 339
Right 1069922180 10:71822466-71822488 CCATTTAAAATGATGCATTAAGG No data
1069922178_1069922180 -2 Left 1069922178 10:71822445-71822467 CCAGATTTTTCAGCGGCAGGACC 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1069922180 10:71822466-71822488 CCATTTAAAATGATGCATTAAGG No data
1069922176_1069922180 3 Left 1069922176 10:71822440-71822462 CCACACCAGATTTTTCAGCGGCA No data
Right 1069922180 10:71822466-71822488 CCATTTAAAATGATGCATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069922180 Original CRISPR CCATTTAAAATGATGCATTA AGG Intronic
No off target data available for this crispr