ID: 1069923339

View in Genome Browser
Species Human (GRCh38)
Location 10:71831079-71831101
Sequence GGGCCCCAGAAGCACCTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069923331_1069923339 15 Left 1069923331 10:71831041-71831063 CCATTTTAATCAATCTACTCTGG 0: 1
1: 0
2: 0
3: 10
4: 202
Right 1069923339 10:71831079-71831101 GGGCCCCAGAAGCACCTTCAAGG 0: 1
1: 0
2: 2
3: 19
4: 210
1069923336_1069923339 -9 Left 1069923336 10:71831065-71831087 CCACTGCCTCTCCTGGGCCCCAG 0: 1
1: 1
2: 12
3: 154
4: 967
Right 1069923339 10:71831079-71831101 GGGCCCCAGAAGCACCTTCAAGG 0: 1
1: 0
2: 2
3: 19
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069923339 Original CRISPR GGGCCCCAGAAGCACCTTCA AGG Intronic
900112459 1:1014250-1014272 GGGCCGCAGCAGCACCTACGAGG + Exonic
901927296 1:12574470-12574492 GGGCCTCAGAATCACCATCATGG - Intronic
902092110 1:13911858-13911880 GGCCCCCAGAAGTCCCTTCTAGG + Intergenic
904810191 1:33158428-33158450 GGGCCCCGCAGCCACCTTCAGGG + Intronic
907240393 1:53077839-53077861 GGGCCCGGGAAGCTCCTTCAGGG + Intronic
909530506 1:76676729-76676751 GGGCCCCAGATGAACCTGGATGG - Intergenic
910401415 1:86841703-86841725 GGGCCTCAGAAGGACATTCCAGG + Intergenic
915259936 1:154670286-154670308 GGGCATCAGAATCACCTACAGGG + Intergenic
915597516 1:156904034-156904056 GGGCCCCTGCTGCACCTTGAGGG + Intronic
915667249 1:157456313-157456335 GATCCTTAGAAGCACCTTCAGGG - Intergenic
915735198 1:158080202-158080224 GGGCAGCAGTAGCACCTTCTAGG - Intronic
916895571 1:169158690-169158712 GGGCATCAGAAGCACCTGGAGGG + Intronic
922155796 1:223038964-223038986 GGGGCCCAAAAGCAGCTGCAAGG + Intergenic
922887615 1:229032031-229032053 GGGCTCCAGGACCTCCTTCAGGG - Intergenic
1069532465 10:69229473-69229495 GGGCCCCAGATGCCCTGTCAAGG - Intronic
1069687821 10:70330439-70330461 GGGGCCTAGAAGCAGCTCCATGG - Intronic
1069923339 10:71831079-71831101 GGGCCCCAGAAGCACCTTCAAGG + Intronic
1070032825 10:72692962-72692984 GACCCCCAAAAGCACCTTTAAGG - Intronic
1070163547 10:73880960-73880982 GGGCCACAGAAGGAACATCAGGG - Intergenic
1070684635 10:78471654-78471676 GGACCCCAGGAGCTCCTTCCTGG + Intergenic
1071958282 10:90782701-90782723 GAGCCTCAGAAGCATCTCCATGG - Intronic
1072806341 10:98425913-98425935 CGGCCCCAGAAGGATCTTCCTGG - Exonic
1072834274 10:98694670-98694692 GGCCCCCAGATGCATCTTCTTGG - Intronic
1074521930 10:114233846-114233868 GGGCCACAAAACCACCTACATGG - Intergenic
1074756562 10:116627967-116627989 GGTCCCCAGGAGGACCATCAGGG - Intronic
1075949727 10:126466609-126466631 GGGCCCCCAAAGCACCTTCCTGG + Intronic
1076025386 10:127107738-127107760 GAGCCCTGGAAGCACCTGCACGG - Intronic
1076180337 10:128402120-128402142 GGGCCCCACAGAAACCTTCAGGG - Intergenic
1076671510 10:132123223-132123245 GGGCCCCAGAAGCAGCTGCGTGG + Intronic
1076852633 10:133100488-133100510 GGGCCCCAGGAGCTCCGTCCAGG - Intronic
1077808485 11:5613317-5613339 GGGCACTTGAAGCTCCTTCATGG + Intronic
1079120512 11:17680768-17680790 GGGATCCAGAAGCATCTTCATGG - Intergenic
1081694158 11:45098093-45098115 GTGCCCTAGCGGCACCTTCAGGG + Intronic
1083664384 11:64266641-64266663 AGGCCCTAGAAGAACCTTGAGGG - Intronic
1084778943 11:71396342-71396364 GGGCCCCAGAAGGAGATCCAGGG + Intergenic
1085289724 11:75389171-75389193 GGGGCCCAGGAGCAGCTGCAAGG - Intergenic
1086333530 11:85777490-85777512 GTGCCTCAGAAGCAGGTTCAGGG - Intronic
1087078875 11:94150894-94150916 GGTCCCCAGGAGCTCCTCCAGGG + Intronic
1089041589 11:115455894-115455916 GGGATCCAGAAGCAACTCCAGGG + Intronic
1089154838 11:116393618-116393640 TGACCCCAGAAGCAGCATCAGGG + Intergenic
1089757148 11:120695372-120695394 GAGCCACAGAAGGCCCTTCACGG - Intronic
1091292660 11:134450519-134450541 GCTCCCCAGAAGCCCCCTCAGGG - Intergenic
1091394035 12:142736-142758 GGATCCCAGTAGCACCTCCATGG - Intronic
1091637316 12:2207094-2207116 GGGCCCCAGGACCACATTCGAGG + Intronic
1092264483 12:6970457-6970479 GGCCCCCAGCAACAGCTTCAGGG + Exonic
1095957269 12:47813898-47813920 GGTCCCCAGAAAAACCTTCCTGG + Intronic
1098141397 12:67453520-67453542 GTGCTCCAGTATCACCTTCATGG + Intergenic
1101489342 12:105197117-105197139 GGGACCCTGAAGCCCCTCCATGG + Intronic
1102018352 12:109663554-109663576 GGGCCCCAGACCCAGCTTAAGGG - Intergenic
1102561730 12:113766966-113766988 AGGCCACAGAAGCAGCTTGATGG + Intergenic
1102627333 12:114245624-114245646 GGGCCCCAGAAGGACACTGATGG + Intergenic
1103027486 12:117585277-117585299 GAGCCTCAGAAGCACCATCTGGG - Intronic
1103854305 12:123955000-123955022 GGGCCTGAGCAGCACCTCCATGG - Intronic
1105741852 13:23333786-23333808 GAGCCCCACAAGCATCTTGAAGG - Exonic
1106691088 13:32117586-32117608 GGGCCCCTGCAGCACCTGCTAGG - Intronic
1107411876 13:40165429-40165451 GGGCTGCAGAAGCATCTGCAAGG + Intergenic
1110802270 13:79712528-79712550 GTGCTTCAGAAGCACCTACATGG + Intergenic
1113081621 13:106526137-106526159 GGGCACCAGAATCCCCTGCAGGG - Intronic
1113936203 13:113996347-113996369 GGGCCCCAGATGCTCCCTCGAGG + Intronic
1119765907 14:77187512-77187534 GGCCCCAAGAAGCCCCTCCATGG - Intronic
1122111915 14:99509168-99509190 GGGAACCAGAAGCATCTTCGTGG + Exonic
1122204588 14:100142246-100142268 GGTCTACAGAAGCACCTTCCAGG + Intronic
1122458510 14:101876565-101876587 TGGCCCAAGAAGCAACTTTACGG - Intronic
1122548344 14:102537303-102537325 GGGCCCCAGAAGTGCCTTGCCGG - Intergenic
1122862183 14:104587654-104587676 GGGGCCCAGCAGCACCGTCCTGG - Intronic
1123714232 15:23014565-23014587 GGGCCTCAGAAGCAGCCTCATGG + Intronic
1125765262 15:42131258-42131280 GCTCCCCAGATGCACCTGCAGGG - Intergenic
1126448985 15:48784707-48784729 GCACTGCAGAAGCACCTTCAAGG - Intronic
1128760125 15:70210821-70210843 GGGGCTCTGAAGCACCTTTAGGG - Intergenic
1129301586 15:74628688-74628710 GGACCCCAGTAGCCCCCTCAGGG + Intronic
1129766726 15:78174370-78174392 GCCCCCCAGACACACCTTCAAGG + Exonic
1132121491 15:99179782-99179804 CTGCCCCAGAAGAACCTCCATGG + Intronic
1132468597 16:89362-89384 GCGCCCCAGAAGAGCCGTCATGG - Intronic
1132648045 16:1008041-1008063 GGACCCAGGAAGCCCCTTCAAGG + Intergenic
1132751211 16:1458552-1458574 AGGCCCCGGAAGCACCCCCAGGG + Intronic
1134504512 16:14794161-14794183 GGACCCCAGATGCACCAGCATGG + Intronic
1134576059 16:15334748-15334770 GGACCCCAGATGCACCAGCATGG - Intergenic
1134726383 16:16421753-16421775 GGACCCCAGATGCACCAGCATGG + Intergenic
1134941048 16:18290106-18290128 GGACCCCAGATGCACCAGCATGG - Intergenic
1136372297 16:29844043-29844065 AGGCCCCAGAAGCAGCTGCCTGG + Intronic
1137984006 16:53092497-53092519 GGGCTCCCAAATCACCTTCATGG - Intronic
1141523279 16:84595457-84595479 GGGACCGAGAACCTCCTTCAGGG - Intronic
1141843457 16:86590243-86590265 TGGCTCCAGAACCACCTCCATGG - Intergenic
1142429047 16:90016568-90016590 GGGCACCAGCAGCCCCTGCAGGG - Intronic
1142470715 17:161848-161870 GGCCCCAGGAAGCACCTTCAGGG + Intronic
1143870450 17:9954334-9954356 GGGCCACAGAAGCACCCTGCAGG + Intronic
1146064213 17:29622419-29622441 GGGCCGCAGACGCGCCTTGAAGG - Intronic
1146077400 17:29744134-29744156 AGGCCCCAGAAGCCCCTGCTGGG + Intronic
1146804551 17:35855008-35855030 GAGCCTGAGAAGCATCTTCAGGG + Exonic
1146891627 17:36510143-36510165 GGGCCCCTGAAGCCCTTACAAGG + Intronic
1148780335 17:50117781-50117803 AGGCCCCGGAAGGACCCTCAGGG - Intronic
1148809130 17:50279187-50279209 GGGCTTCAGAATCACCTGCAGGG - Exonic
1149328941 17:55561515-55561537 GAGCGCCAGTGGCACCTTCAGGG + Intergenic
1150215689 17:63467754-63467776 GACCCTCATAAGCACCTTCAAGG + Intergenic
1150457011 17:65314254-65314276 GGGCCCTAGCAGCAGGTTCAGGG - Intergenic
1151714625 17:75825125-75825147 GGGCCCTTGAAGCTCCTTGAGGG + Exonic
1152563273 17:81089228-81089250 GGGCCCCTGAGGCACCAACATGG - Intronic
1152944147 17:83189953-83189975 GGGCCCCTGGAGCAGCTCCAGGG - Intergenic
1153519675 18:5939950-5939972 GGGCCCAAGAAGCAGGTGCATGG - Intergenic
1158393735 18:57063755-57063777 GGCACCCAGGAGCACCTTCTGGG + Intergenic
1161434477 19:4254482-4254504 TGGCCCCCGACTCACCTTCATGG - Exonic
1163520352 19:17788124-17788146 GGGCCCCAGGAGCCCCTTGTTGG - Intronic
1164150772 19:22548575-22548597 GGGCACCAGCAGTACCTTCAGGG - Intergenic
1164553567 19:29232648-29232670 GGTCCCCTGGAGCACCTTCCAGG - Intergenic
1164720556 19:30428916-30428938 GGGCCTCAGAGGCACCCACAGGG + Intronic
1165112921 19:33512728-33512750 GAGCGCCAGCGGCACCTTCAGGG + Exonic
1165767237 19:38359225-38359247 GGGCCCCTGAGCCACCTTCTTGG + Intronic
1166610646 19:44191545-44191567 GGGCCCCTGGAGAACCTTAAAGG - Intergenic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
925201215 2:1968930-1968952 GTGCCCCAGAAGCACCTAGGGGG - Intronic
926243841 2:11107543-11107565 AGACCCCAGCAGCACCTTCATGG - Intergenic
927210333 2:20635134-20635156 AGCCCCCAGAAGCAGCTTCAGGG + Intronic
928133332 2:28669223-28669245 AGGCCCCAGAAGGAAATTCAGGG - Intergenic
929022962 2:37572218-37572240 CAGCCACAGAAGAACCTTCATGG - Intergenic
931123015 2:59241594-59241616 GTGCACCAGAAGCACCTTCAAGG + Intergenic
933719512 2:85389103-85389125 GGGCCTCAGAATCCCCTACAGGG - Intronic
935588995 2:104827880-104827902 AGGCACCAGAAGAACCATCAAGG + Intergenic
937906892 2:127056847-127056869 GCTCCCCAGAGGCACCTCCACGG + Intronic
937912257 2:127081424-127081446 GGGCCCCAGCAGCCCCTCCTGGG + Intronic
937943177 2:127305625-127305647 AGGCCCCAGAATCCCTTTCATGG - Exonic
938053553 2:128196315-128196337 GGGCACAAGAAGGCCCTTCAGGG + Intergenic
938682565 2:133706519-133706541 GGGCCTCACAAGCACCTGCAGGG + Intergenic
939614825 2:144350429-144350451 GTGGGCCAGAAGCACCTTCTTGG - Intergenic
940982282 2:160017208-160017230 GTGCTCCAGAAGCACCTGGAGGG + Intronic
941860279 2:170272267-170272289 GAGCCTCAGAAGCACCCACAGGG - Intronic
945447311 2:209953525-209953547 GGGTGCCAGAAACACCTTGAAGG - Intronic
947773511 2:232689629-232689651 AGTCCCCAGAAGCACCAGCAGGG + Intergenic
948530184 2:238599251-238599273 GGGCCCCTGAGGCTCCTCCACGG - Intergenic
1168993801 20:2117146-2117168 GGTCCCCAGGAGCTCCTTCTTGG - Exonic
1170293291 20:14795139-14795161 GGGCCCTACAAGGTCCTTCACGG - Intronic
1170442341 20:16391596-16391618 TGGCACCAGATGCATCTTCATGG - Intronic
1172568933 20:35954051-35954073 GGGCCCGAGAGGCAGCTCCAGGG + Exonic
1173351844 20:42252754-42252776 GGGCCACAGAAGAACATTCAGGG + Intronic
1174054420 20:47788209-47788231 AGGCCCCAGAAGCACCACCAAGG - Intergenic
1174133892 20:48365518-48365540 GCCCCCCAGAAGCCCCTTCCAGG + Intergenic
1176082638 20:63281685-63281707 GAGCCCCAGAAGAAGCTCCAGGG - Intronic
1176386564 21:6141023-6141045 GGGCCACAGAAGCAACACCACGG + Intergenic
1178510018 21:33197085-33197107 CTGCCGGAGAAGCACCTTCACGG - Intergenic
1179736909 21:43397229-43397251 GGGCCACAGAAGCAACACCACGG - Intergenic
1180674589 22:17578516-17578538 GGGACCCTAAAGCAGCTTCAGGG + Intronic
1181415657 22:22756884-22756906 GGACCACAGATGCACCTGCAGGG + Intronic
1181668048 22:24411993-24412015 GGGCCCAAGAAGCTCCGTGAAGG + Intronic
1182092742 22:27607055-27607077 AGGCCCCAGAAGAACATTGAGGG + Intergenic
1182317240 22:29456128-29456150 GGCCCCCAGAAGGTCCTGCAGGG + Intergenic
1182350398 22:29696007-29696029 GGGCCACAGAACCACCCCCACGG + Exonic
1183272084 22:36868585-36868607 GGGCTCCAGCTGCTCCTTCAGGG + Intronic
1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG + Exonic
1184482556 22:44756347-44756369 GGGCCTCAGAGGTACCTTCAGGG - Intronic
1185225059 22:49647527-49647549 GGGGCACAGCAGCCCCTTCAGGG - Intronic
950081850 3:10228262-10228284 GGGCCCCAGAAGCATCCCCTGGG + Intronic
950435121 3:12974804-12974826 GAGCCACAGCAGCACCCTCAGGG + Intronic
952042106 3:29273499-29273521 GGTCCCCACAATAACCTTCAGGG + Intergenic
953537438 3:43786929-43786951 TGGCCCCAGCAGCATGTTCAAGG - Intergenic
953764920 3:45731765-45731787 GGGCCCCAGAAGAACCTGTGAGG + Intronic
953784578 3:45901435-45901457 GAACCCCAGAATGACCTTCAGGG - Exonic
954520251 3:51218804-51218826 GTGCCTCAGAATCACCTGCAAGG + Intronic
954939642 3:54359838-54359860 GTGCCCCAAAAGCTACTTCAGGG - Intronic
955541771 3:59984277-59984299 GGGCCCAGGAAGCACCATTAGGG + Intronic
955922642 3:63973791-63973813 GGGCCCCAGAACCAGCCACATGG - Intronic
959465556 3:106681999-106682021 GTGCCACAGAAGCATTTTCAAGG - Intergenic
961047789 3:123721386-123721408 GGACCCAAGAAGCACTTCCACGG + Intronic
961319451 3:126062904-126062926 TGCCCCCAGAAACGCCTTCATGG + Intronic
961321252 3:126078052-126078074 GGGCCCCTGCAGGTCCTTCAGGG - Intronic
961519093 3:127456578-127456600 GGGCCCTACAAGCGGCTTCAGGG + Intergenic
962095941 3:132292701-132292723 GGGCCCCTGAGACTCCTTCAGGG - Intergenic
964744331 3:159998143-159998165 TGGCCACAGAAACAGCTTCATGG + Intergenic
965641594 3:170834618-170834640 GTGCACCAGAATCACCTTGAGGG - Intronic
966867493 3:184267231-184267253 GGGCCCTAGAAATACCCTCATGG - Intronic
967881909 3:194307495-194307517 TTGCACCAGAAGCACCTGCAGGG + Intergenic
969470001 4:7382082-7382104 GGCCTCCAGAAGGACCTTGAAGG + Intronic
972579205 4:40380008-40380030 GGGGCCTAGAAGCACCTACTTGG - Intergenic
977270308 4:94909898-94909920 GAGCCACAGAAGTACCTTAAAGG - Intronic
983209068 4:164940132-164940154 TGGCTCCAGAAGCAGCTCCAGGG + Intergenic
986131484 5:4936164-4936186 CTGCCCCAGGAACACCTTCAAGG + Intergenic
987681319 5:21139652-21139674 GGACACCAGAATCACTTTCATGG + Intergenic
992447914 5:76850525-76850547 AAGACCCAGAAGAACCTTCAAGG + Intronic
993661176 5:90636679-90636701 GGGGCCCTGAATCACCTTGAGGG - Intronic
995710025 5:115025951-115025973 GTTCTCCAGAAGCTCCTTCATGG - Intergenic
997371488 5:133364023-133364045 TGTCCCCAGCAGCACATTCAGGG - Intronic
997659953 5:135581886-135581908 TGGCCCCTGACACACCTTCAGGG + Intergenic
997725157 5:136114085-136114107 GGGCCCCAGCAGGAGCTCCATGG + Intergenic
998133227 5:139661478-139661500 GTGCTCCAGAAGCACACTCACGG + Intronic
998498430 5:142611254-142611276 GGGCAACAGAACCACATTCAGGG + Intronic
999438162 5:151580549-151580571 GGGCCCCAGGAGCCCCTTGTGGG + Intergenic
1001448692 5:171807362-171807384 GGGCCCCCGTAGCACCTGCAGGG + Intergenic
1001664391 5:173420626-173420648 GGGCCCAAGCAGCTCCTTTAGGG + Intergenic
1002642800 5:180638450-180638472 GGGCCCCAGAAGCCACTTTGGGG - Intronic
1002881290 6:1254729-1254751 TTGCCCCAGAACCACCCTCATGG + Intergenic
1006144683 6:31951547-31951569 GGCCGCCAGAATCACCTGCAAGG - Exonic
1013461162 6:110376779-110376801 GTGCCCCAGAAGCACCAGAAGGG - Intergenic
1014689378 6:124544182-124544204 GGATCCCTGAAGAACCTTCAGGG + Intronic
1019284694 7:217612-217634 AGGCCTCAGAAGCCGCTTCAGGG - Intronic
1021582125 7:22167216-22167238 GGGCCCCAGAACCATGTGCATGG + Intronic
1023941102 7:44768811-44768833 GGGCCCCAAAAGCCACTTGAAGG - Exonic
1024310744 7:47966706-47966728 GGTTCTCAGAAGCACCTTTAAGG + Intronic
1029248362 7:99218752-99218774 GGCCCCCAGAGGCACCTCCGTGG + Intergenic
1029970427 7:104783160-104783182 GTGCACCAGAAGCACCTTGTGGG - Intronic
1030408256 7:109142759-109142781 TGGGCCCAGAAGTACCTTCAGGG + Intergenic
1032413998 7:131722296-131722318 GCCCCCAAGAAGCAGCTTCAAGG - Intergenic
1032472569 7:132189206-132189228 GTGCCCCAGCAACACCTGCAGGG - Intronic
1034214469 7:149394497-149394519 GGGTCCTAGCAGCAGCTTCAGGG - Intergenic
1034434004 7:151054497-151054519 GGGCCACAGCTGCATCTTCAGGG + Intronic
1035132952 7:156672922-156672944 GGGCCTCAGAATCACCTGGAGGG + Intronic
1035596253 8:860396-860418 GGGCTCCAGAAACACTTTCAAGG + Intergenic
1035632610 8:1120213-1120235 GAGCCACAGAAGCAGCTGCATGG - Intergenic
1036757709 8:11482259-11482281 TGGCCCCAGAGCCACCTGCAGGG - Intergenic
1036796127 8:11757924-11757946 GGGCACCAGGAGCCCCTTCTGGG + Intronic
1037897888 8:22670246-22670268 GGGGCCCAGCAGCACCTGCACGG - Intergenic
1040436254 8:47394279-47394301 GAGCCCCAGCAGTACCTCCATGG + Intronic
1044323617 8:90834454-90834476 GGGACACACAAGCTCCTTCAGGG - Intronic
1044830768 8:96245564-96245586 GGGCAACAGAAGCAGTTTCAGGG + Intronic
1045332729 8:101169724-101169746 TGGACCCAGAAGCACCATCCTGG - Intergenic
1047098208 8:121646820-121646842 GGGACCCTGAAGCCCTTTCAGGG - Intergenic
1048753884 8:137713132-137713154 GGGACCCAGAAGGACCCTGATGG - Intergenic
1049047180 8:140161994-140162016 TGTCCACAGAGGCACCTTCAGGG - Intronic
1049270384 8:141692599-141692621 GGGGCCCAGCAGCTGCTTCAGGG + Intergenic
1053117992 9:35522350-35522372 GGGCCCCAGAGGCACCTCCAGGG - Intronic
1053156620 9:35785328-35785350 GAACCCCTGAGGCACCTTCAGGG - Intergenic
1055511138 9:76996842-76996864 GTGTCCCAGAGGCCCCTTCAAGG + Intergenic
1058827965 9:108792050-108792072 GGGACCCAGAAGAACTTTCTAGG + Intergenic
1059500256 9:114746282-114746304 GAGGCCCAGCAGAACCTTCAGGG + Intergenic
1060023974 9:120155545-120155567 GGCTCCCAGAAGGCCCTTCAGGG - Intergenic
1060309261 9:122444741-122444763 GAGACCAAGAGGCACCTTCAAGG - Intergenic
1060442488 9:123654889-123654911 GGGCCCCAGGAGCAGCTGCAGGG + Intronic
1061895097 9:133643064-133643086 GGGCCCAAAGCGCACCTTCAAGG - Intronic
1062316896 9:135971791-135971813 GGGCCTCCGAAGCCCCTTCTGGG + Intergenic
1062522530 9:136964170-136964192 AAGCCCCAGAACCACCTCCAGGG - Intergenic
1185642686 X:1597327-1597349 GGGCCCCCCCAGCACATTCACGG - Intronic
1189250695 X:39598945-39598967 GTGCCCCAGAACCCCCTGCAGGG + Intergenic
1189353531 X:40294895-40294917 GAGCCCAAGCAGCACCATCAAGG - Intergenic
1195863487 X:109406155-109406177 GATCCCCAGAAGCTCCTCCATGG + Intronic
1199067523 X:143437583-143437605 GGATTCCAGAAGCACCTTCGGGG + Intergenic