ID: 1069923689

View in Genome Browser
Species Human (GRCh38)
Location 10:71833334-71833356
Sequence CTGTGGTTCCAGTACTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069923685_1069923689 -3 Left 1069923685 10:71833314-71833336 CCAGGCATACTGGTCCACATCTG 0: 1
1: 1
2: 36
3: 829
4: 7869
Right 1069923689 10:71833334-71833356 CTGTGGTTCCAGTACTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069923689 Original CRISPR CTGTGGTTCCAGTACTCAGG AGG Intronic
No off target data available for this crispr